OPEDVar

QUERY TYPE Select query type and 'AlleleID','GeneID',
'GeneSymbol' and 'HGNC_ID' QUERY ITEM Enter the AlleleID,GeneID,GeneSymbol or HGNC_ID PAM Select PAM type between 'NGG' and 'NG' DIRECTION Select edit direction which means to install
or correct pathogenic human genetic variants ASSEMBLY
HISTORY

Download
AlleleID Type Chromosome Start Stop ReferenceAllele AlternateAllele Spacer PBS RTT PAM
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAAT TCATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAAT CATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAA TCATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAA CATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAATT TCATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAATT CATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAAT TTCATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAATTG TCATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAATTG CATCTCAGCCAAAA NGG
168851 single nucleotide variant 11 118468800 118468800 C G GATGAGCAATTCTTAGGTTT CCTAAGAA TTCATCTCAGCCAAAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT CCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCTT CCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCTTG CCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT TTGGCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCTT TTGGCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT GCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT TGGCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT GGCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCTT GCCGTATCTGAA NGG
791104 single nucleotide variant 11 118468845 118468845 G A AGTCCCACAAGGTCTCCTTC GGAGACCT ATTGGCCGTATCTGAA NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAAGTG GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAAG GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAAGT GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAG GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAA GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGA GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTA GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCT GTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAAG AGTCCTTGAAAACCTCGT NGG
611741 single nucleotide variant 11 118471676 118471676 C T CCACTTCTAGGTCTCCCACG GGGAGACCTAGAA AGTCCTTGAAAACCTCGT NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATC CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCT CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTG CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGT CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGTG CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGTGT CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATC GCTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGTGTT CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGTGTTT CTATCCTCTA NGG
805092 single nucleotide variant 11 118471731 118471731 C A AAAACACAGATGGATCTGAG AGATCCATCTGTGTTTT CTATCCTCTA NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGA GAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGAG GAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGA TGAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGAG TGAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGAGA GAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTG GAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T TCAAGTCTAAGTTTAAGACA CTTAAACTTAGACTTG TGAAGCTACCCTGT NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTGAGA TGAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T CTCAAGTCTAAGTTTAAGAC TTAAACTTAGACTTG TGAAGCTACCCTGTC NGG
904301 single nucleotide variant 11 118472024 118472024 A T TCAAGTCTAAGTTTAAGACA CTTAAACTTAGACTTGA TGAAGCTACCCTGT NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTCC GAGCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTC GAGCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTCC GGAGCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GGCAGTGGAGGATGAACTTC GTTCATCCTCC GGAGCGATACCCCTTAA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GGCAGTGGAGGATGAACTTC GTTCATCCTCCA GGAGCGATACCCCTTAA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTC GCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTC AGCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTC GGAGCGATACCCCTTA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GGCAGTGGAGGATGAACTTC GTTCATCCTCC GAGCGATACCCCTTAA NGG
511884 single nucleotide variant 11 118472681 118472681 G T GCAGTGGAGGATGAACTTCA AGTTCATCCTCCA GAGCGATACCCCTTA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT CCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCTC CCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCTCC CCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCTCCT CCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT CAAAGTGCCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT GCCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT GTGCCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT AAAGTGCCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT ACAAAGTGCCCCCTAGCA NGG
1020807 single nucleotide variant 11 118472819 118472819 C T GAGACGAGGAGGTCTGCTGC GCAGACCT AAGTGCCCCCTAGCA NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGC TTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCA TTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAG TTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGG GATTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGGA TTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGGA GATTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGGA ATTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCA ATTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGG ATTTTCACTTCCCTTGC NGG
838040 single nucleotide variant 11 118472981 118472981 C T GCTTCCACTGCTCCTATGCA ATAGGAGCAGTGG TTTTCACTTCCCTTGC NGG
178383 single nucleotide variant 11 118473392 118473392 C T CTTGTCCTCATGGAGTGAGA CACTCCATGAGGA CTATTTGATCTGAACCAAGATCTCCTTCT NGG
178383 single nucleotide variant 11 118473392 118473392 C T CTTGTCCTCATGGAGTGAGA CACTCCATGAGGAC CTATTTGATCTGAACCAAGATCTCCTTCT NGG
178383 single nucleotide variant 11 118473392 118473392 C T CTTGTCCTCATGGAGTGAGA CACTCCATGAGGA GTCCTATTTGATCTGAACCAAGATCTCCTTCT NGG
178383 single nucleotide variant 11 118473392 118473392 C T CTTGTCCTCATGGAGTGAGA CACTCCATGAGGAC GTCCTATTTGATCTGAACCAAGATCTCCTTCT NGG
178383 single nucleotide variant 11 118473392 118473392 C T CTTGTCCTCATGGAGTGAGA CACTCCATGAGGA TCCTATTTGATCTGAACCAAGATCTCCTTCT NGG
178383 single nucleotide variant 11 118473392 118473392 C T CTTGTCCTCATGGAGTGAGA CACTCCATGAGGA CCTATTTGATCTGAACCAAGATCTCCTTCT NGG
178383 single nucleotide variant 11 118473392 118473392 C T CTTGTCCTCATGGAGTGAGA CACTCCATGAGGAC CCTATTTGATCTGAACCAAGATCTCCTTCT NGG
178383 single nucleotide variant 11 118473392 118473392 C T CTTGTCCTCATGGAGTGAGA CACTCCATGAGGAC TCCTATTTGATCTGAACCAAGATCTCCTTCT NGG
178383 single nucleotide variant 11 118473392 118473392 C T CTTGTCCTCATGGAGTGAGA CACTCCATGAGGA AGTCCTATTTGATCTGAACCAAGATCTCCTTCT NGG
178383 single nucleotide variant 11 118473392 118473392 C T CTTGTCCTCATGGAGTGAGA CACTCCATGAGGAC AGTCCTATTTGATCTGAACCAAGATCTCCTTCT NGG
1165977 single nucleotide variant 11 118473572 118473572 C T GGAGCACTAGTCTGCTTCCT AAGCAGACTAGT TCCTTCTCATTCCCTGACTTAGTCTGGGGAATCTGCAGAGAAAAATCAGAGACCAAGG NGG
1165977 single nucleotide variant 11 118473572 118473572 C T GGAGCACTAGTCTGCTTCCT AAGCAGACTAGT TACTTTTCCTTCTCATTCCCTGACTTAGTCTGGGGAATCTGCAGAGAAAAATCAGAGACCAAGG NGG
1165977 single nucleotide variant 11 118473572 118473572 C T GGAGCACTAGTCTGCTTCCT AAGCAGACTAGTG TCCTTCTCATTCCCTGACTTAGTCTGGGGAATCTGCAGAGAAAAATCAGAGACCAAGG NGG
1165977 single nucleotide variant 11 118473572 118473572 C T GGAGCACTAGTCTGCTTCCT AAGCAGACTAG TACTTTTCCTTCTCATTCCCTGACTTAGTCTGGGGAATCTGCAGAGAAAAATCAGAGACCAAGG NGG
1165977 single nucleotide variant 11 118473572 118473572 C T GGAGCACTAGTCTGCTTCCT AAGCAGACTAGT TTCCTTCTCATTCCCTGACTTAGTCTGGGGAATCTGCAGAGAAAAATCAGAGACCAAGG NGG
1165977 single nucleotide variant 11 118473572 118473572 C T GGAGCACTAGTCTGCTTCCT AAGCAGACTAG TCCTTCTCATTCCCTGACTTAGTCTGGGGAATCTGCAGAGAAAAATCAGAGACCAAGG NGG
1165977 single nucleotide variant 11 118473572 118473572 C T GGAGCACTAGTCTGCTTCCT AAGCAGACTAG TTCCTTCTCATTCCCTGACTTAGTCTGGGGAATCTGCAGAGAAAAATCAGAGACCAAGG NGG
1165977 single nucleotide variant 11 118473572 118473572 C T GGAGCACTAGTCTGCTTCCT AAGCAGACTAGT TCTCATTCCCTGACTTAGTCTGGGGAATCTGCAGAGAAAAATCAGAGACCAAGG NGG
1165977 single nucleotide variant 11 118473572 118473572 C T GGAGCACTAGTCTGCTTCCT AAGCAGACTAGTG TCTCATTCCCTGACTTAGTCTGGGGAATCTGCAGAGAAAAATCAGAGACCAAGG NGG
1165977 single nucleotide variant 11 118473572 118473572 C T GGAGCACTAGTCTGCTTCCT AAGCAGACTAGT CTTCTCATTCCCTGACTTAGTCTGGGGAATCTGCAGAGAAAAATCAGAGACCAAGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC CTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC TAGTCTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC AGTCTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTG CTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC ACTAGTCTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC CTAGTCTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCT CTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTC CTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTCTGC GTCTGCTACCTTGG NGG
1087065 single nucleotide variant 11 118473611 118473611 A T CAGAGAAAAATCAGAGACCA TCTCTGATTTTTCTC AGTCTGCTACCTTGG NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACTCT CTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACTC CTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTAC CTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCT CTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T acaagagtagagagagagac TCTCTCTCTACTC TTCTCTCTACCGGTC NGG
444729 single nucleotide variant 11 118473794 118473794 G T acaagagtagagagagagac TCTCTCTCTACTCT TTCTCTCTACCGGTC NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACTCT TTCTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACTC TTCTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACT CTCTCTACCGGT NGG
444729 single nucleotide variant 11 118473794 118473794 G T caagagtagagagagagacc CTCTCTCTCTACTCTT CTCTCTACCGGT NGG
1174310 single nucleotide variant 11 118473849 118473849 C G TCTTTGGAAACCCTACCCAC GGTAGGGT GGGATGAGAAATTCAGAGTAGTTCTGCTTTGTATCCTGTG NGG
1174310 single nucleotide variant 11 118473849 118473849 C G TCTTTGGAAACCCTACCCAC GGTAGGGT AGGGATGAGAAATTCAGAGTAGTTCTGCTTTGTATCCTGTG NGG
1174310 single nucleotide variant 11 118473849 118473849 C G TCTTTGGAAACCCTACCCAC GGTAGGGTTTCC GGGATGAGAAATTCAGAGTAGTTCTGCTTTGTATCCTGTG NGG
1174310 single nucleotide variant 11 118473849 118473849 C G TCTTTGGAAACCCTACCCAC GGTAGGGTTTCC AGGGATGAGAAATTCAGAGTAGTTCTGCTTTGTATCCTGTG NGG
1174310 single nucleotide variant 11 118473849 118473849 C G TCTTTGGAAACCCTACCCAC GGTAGGGT AAGGGATGAGAAATTCAGAGTAGTTCTGCTTTGTATCCTGTG NGG
1174310 single nucleotide variant 11 118473849 118473849 C G TCTTTGGAAACCCTACCCAC GGTAGGGT GGGAGTCAAGGAAAGAGAAAAGGAAAAAGGGATGAGAAATTCAGAGTAGTTCTGCTTTGTATCCTGTG NGG
1174310 single nucleotide variant 11 118473849 118473849 C G TCTTTGGAAACCCTACCCAC GGTAGGGT GGAGTCAAGGAAAGAGAAAAGGAAAAAGGGATGAGAAATTCAGAGTAGTTCTGCTTTGTATCCTGTG NGG
1174310 single nucleotide variant 11 118473849 118473849 C G TCTTTGGAAACCCTACCCAC GGTAGGGTTTCC AAGGGATGAGAAATTCAGAGTAGTTCTGCTTTGTATCCTGTG NGG
1174310 single nucleotide variant 11 118473849 118473849 C G TCTTTGGAAACCCTACCCAC GGTAGGGT AAAGGGATGAGAAATTCAGAGTAGTTCTGCTTTGTATCCTGTG NGG
1174310 single nucleotide variant 11 118473849 118473849 C G TCTTTGGAAACCCTACCCAC GGTAGGGTTTCC GGGAGTCAAGGAAAGAGAAAAGGAAAAAGGGATGAGAAATTCAGAGTAGTTCTGCTTTGTATCCTGTG NGG
513312 single nucleotide variant 11 118474055 118474055 A T TTCTCCAGGGATGGGGCAGT GCCCCATCCCTG AAGGGTGAGGAAATCTGGAAAAAACCAACTTGGACCTCGGCCCAACT NGG
513312 single nucleotide variant 11 118474055 118474055 A T TTCTCCAGGGATGGGGCAGT GCCCCATCCCTGG AAGGGTGAGGAAATCTGGAAAAAACCAACTTGGACCTCGGCCCAACT NGG
513312 single nucleotide variant 11 118474055 118474055 A T TTCTCCAGGGATGGGGCAGT GCCCCATCCCT AAGGGTGAGGAAATCTGGAAAAAACCAACTTGGACCTCGGCCCAACT NGG
513312 single nucleotide variant 11 118474055 118474055 A T TTCTCCAGGGATGGGGCAGT GCCCCATCCC AAGGGTGAGGAAATCTGGAAAAAACCAACTTGGACCTCGGCCCAACT NGG
513312 single nucleotide variant 11 118474055 118474055 A T TTCTCCAGGGATGGGGCAGT GCCCCATCCCTG AAAGGGTGAGGAAATCTGGAAAAAACCAACTTGGACCTCGGCCCAACT NGG
513312 single nucleotide variant 11 118474055 118474055 A T TTCTCCAGGGATGGGGCAGT GCCCCATCC AAGGGTGAGGAAATCTGGAAAAAACCAACTTGGACCTCGGCCCAACT NGG
513312 single nucleotide variant 11 118474055 118474055 A T TTCTCCAGGGATGGGGCAGT GCCCCATCCC AAAGGGTGAGGAAATCTGGAAAAAACCAACTTGGACCTCGGCCCAACT NGG
513312 single nucleotide variant 11 118474055 118474055 A T TTCTCCAGGGATGGGGCAGT GCCCCATCCCTGG AAAGGGTGAGGAAATCTGGAAAAAACCAACTTGGACCTCGGCCCAACT NGG
513312 single nucleotide variant 11 118474055 118474055 A T TTCTCCAGGGATGGGGCAGT GCCCCATCCCT AAAGGGTGAGGAAATCTGGAAAAAACCAACTTGGACCTCGGCCCAACT NGG
513312 single nucleotide variant 11 118474055 118474055 A T TTCTCCAGGGATGGGGCAGT GCCCCATCCCTG GAAAGGGTGAGGAAATCTGGAAAAAACCAACTTGGACCTCGGCCCAACT NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGG CTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGGA CTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATG CTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGG TTGTCTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGG TGTCTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGGAG CTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGG TGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGGA TGTCTGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGGA TGCCTAAG NGG
611742 single nucleotide variant 11 118474193 118474193 C T CATAGGCTCCATGTTGGCTC CCAACATGGA TTGTCTGCCTAAG NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTC GTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTCT GTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTC GGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGT GTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTC GGGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTCT GGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGT GGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTCT GGGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGTC CGGGGTCCTCAC NGG
425905 single nucleotide variant 11 118476838 118476838 C T TCATCAGAGACCTCTGTGCG ACAGAGGT GGGTCCTCAC NGG
611743 single nucleotide variant 11 118476895 118476895 C T CATGGTAAGGCACTCAGGGT CTGAGTGCC GAAAATGAGCTGTGTTTCCTGATGACATGCCCACC NGG
611743 single nucleotide variant 11 118476895 118476895 C T CATGGTAAGGCACTCAGGGT CTGAGTGCC CGAAAATGAGCTGTGTTTCCTGATGACATGCCCACC NGG
611743 single nucleotide variant 11 118476895 118476895 C T CATGGTAAGGCACTCAGGGT CTGAGTGCC TGGCCGAAAATGAGCTGTGTTTCCTGATGACATGCCCACC NGG
611743 single nucleotide variant 11 118476895 118476895 C T CATGGTAAGGCACTCAGGGT CTGAGTGCC TTGGCCGAAAATGAGCTGTGTTTCCTGATGACATGCCCACC NGG
611743 single nucleotide variant 11 118476895 118476895 C T CATGGTAAGGCACTCAGGGT CTGAGTGCC CCGAAAATGAGCTGTGTTTCCTGATGACATGCCCACC NGG
611743 single nucleotide variant 11 118476895 118476895 C T CATGGTAAGGCACTCAGGGT CTGAGTGCC GGCCGAAAATGAGCTGTGTTTCCTGATGACATGCCCACC NGG
611743 single nucleotide variant 11 118476895 118476895 C T CATGGTAAGGCACTCAGGGT CTGAGTGCC GCCGAAAATGAGCTGTGTTTCCTGATGACATGCCCACC NGG
611743 single nucleotide variant 11 118476895 118476895 C T CATGGTAAGGCACTCAGGGT CTGAGTGCC CTTGGCCGAAAATGAGCTGTGTTTCCTGATGACATGCCCACC NGG
611743 single nucleotide variant 11 118476895 118476895 C T CATGGTAAGGCACTCAGGGT CTGAGTGCC CCTTGGCCGAAAATGAGCTGTGTTTCCTGATGACATGCCCACC NGG
611743 single nucleotide variant 11 118476895 118476895 C T CATGGTAAGGCACTCAGGGT CTGAGTGCCT GAAAATGAGCTGTGTTTCCTGATGACATGCCCACC NGG
424701 single nucleotide variant 11 118476983 118476983 G A CTTCCATGGGGAATGATGGT ATCATTCCCC CTTGACCTATC NGG
424701 single nucleotide variant 11 118476983 118476983 G A CTTCCATGGGGAATGATGGT ATCATTCCC CTTGACCTATC NGG
424701 single nucleotide variant 11 118476983 118476983 G A CTTCCATGGGGAATGATGGT ATCATTCCCCA CTTGACCTATC NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGGA TTGACCTATCATCA NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGG TTGACCTATCATCA NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGG TGACCTATCATCA NGG
424701 single nucleotide variant 11 118476983 118476983 G A CTTCCATGGGGAATGATGGT ATCATTCCCCATGGA CTTGACCTATC NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGGA ACCTATCATCA NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGGA TGACCTATCATCA NGG
424701 single nucleotide variant 11 118476983 118476983 G A TTGTCTTCCATGGGGAATGA TTCCCCATGG CTTGACCTATCATCA NGG
481237 single nucleotide variant 11 118477973 118477973 C A GGTTTGATGGGTGGAGCAAG GCTCCACCC CAAGTAATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
481237 single nucleotide variant 11 118477973 118477973 C A GGTTTGATGGGTGGAGCAAG GCTCCACCC ACAAGTAATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
481237 single nucleotide variant 11 118477973 118477973 C A GGTTTGATGGGTGGAGCAAG GCTCCACCC GACAAGTAATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
481237 single nucleotide variant 11 118477973 118477973 C A GGTTTGATGGGTGGAGCAAG GCTCCACCCA CAAGTAATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
481237 single nucleotide variant 11 118477973 118477973 C A GGTTTGATGGGTGGAGCAAG GCTCCACCCA ACAAGTAATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
481237 single nucleotide variant 11 118477973 118477973 C A GGTTTGATGGGTGGAGCAAG GCTCCACCC AGACAAGTAATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
481237 single nucleotide variant 11 118477973 118477973 C A GGTTTGATGGGTGGAGCAAG GCTCCACCCA GACAAGTAATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
481237 single nucleotide variant 11 118477973 118477973 C A GGTTTGATGGGTGGAGCAAG GCTCCACCCA AGACAAGTAATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
481237 single nucleotide variant 11 118477973 118477973 C A GGTTTGATGGGTGGAGCAAG GCTCCACCCAT CAAGTAATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
481237 single nucleotide variant 11 118477973 118477973 C A GGTTTGATGGGTGGAGCAAG GCTCCACCC CAGACAAGTAATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
511888 single nucleotide variant 11 118478083 118478083 C T GTCCTCAGGCACCTGGCAGC GCCAGGTGCC GGACGTTGATCGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
511888 single nucleotide variant 11 118478083 118478083 C T GTCCTCAGGCACCTGGCAGC GCCAGGTGCC AGGACGTTGATCGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
511888 single nucleotide variant 11 118478083 118478083 C T GTCCTCAGGCACCTGGCAGC GCCAGGTGCC GACGTTGATCGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
511888 single nucleotide variant 11 118478083 118478083 C T GTCCTCAGGCACCTGGCAGC GCCAGGTGCC AAGGACGTTGATCGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
511888 single nucleotide variant 11 118478083 118478083 C T GTCCTCAGGCACCTGGCAGC GCCAGGTGCC AAAGGACGTTGATCGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
511888 single nucleotide variant 11 118478083 118478083 C T GTCCTCAGGCACCTGGCAGC GCCAGGTGCCT GGACGTTGATCGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
511888 single nucleotide variant 11 118478083 118478083 C T GTCCTCAGGCACCTGGCAGC GCCAGGTGCC GAAAGGACGTTGATCGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
511888 single nucleotide variant 11 118478083 118478083 C T GTCCTCAGGCACCTGGCAGC GCCAGGTGCCT AGGACGTTGATCGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
511888 single nucleotide variant 11 118478083 118478083 C T GTCCTCAGGCACCTGGCAGC GCCAGGTGC GGACGTTGATCGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
511888 single nucleotide variant 11 118478083 118478083 C T GTCCTCAGGCACCTGGCAGC GCCAGGTGC AGGACGTTGATCGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
791105 single nucleotide variant 11 118478087 118478087 C A TAAAGAAAGGACGTCGATCG TCGACGTC CACCGCCTCTA NGG
791105 single nucleotide variant 11 118478087 118478087 C A TAAAGAAAGGACGTCGATCG TCGACGTCC CACCGCCTCTA NGG
791105 single nucleotide variant 11 118478087 118478087 C A GTCCTCAGGCACCTGGCAGC GCCAGGTGCC TCGATAGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
791105 single nucleotide variant 11 118478087 118478087 C A GTCCTCAGGCACCTGGCAGC GCCAGGTGCC GTCGATAGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
791105 single nucleotide variant 11 118478087 118478087 C A GTCCTCAGGCACCTGGCAGC GCCAGGTGCC ACGTCGATAGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
791105 single nucleotide variant 11 118478087 118478087 C A GTCCTCAGGCACCTGGCAGC GCCAGGTGCC AGGACGTCGATAGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
791105 single nucleotide variant 11 118478087 118478087 C A GTCCTCAGGCACCTGGCAGC GCCAGGTGCC GGACGTCGATAGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
791105 single nucleotide variant 11 118478087 118478087 C A GTCCTCAGGCACCTGGCAGC GCCAGGTGCC CGTCGATAGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
791105 single nucleotide variant 11 118478087 118478087 C A GTCCTCAGGCACCTGGCAGC GCCAGGTGCC GACGTCGATAGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
791105 single nucleotide variant 11 118478087 118478087 C A GTCCTCAGGCACCTGGCAGC GCCAGGTGCC AAGGACGTCGATAGAGGCGGTGTGGGCAGTGTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GGACGTCGATCGAGGCGGTG CGCCTCGATCG CGGGAGACTGCCCACAC NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCCTG GGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GGACGTCGATCGAGGCGGTG CGCCTCGATCGA CGGGAGACTGCCCACAC NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCCTG TGGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCC GGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCC TGGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCCT GGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GGACGTCGATCGAGGCGGTG CGCCTCGAT CGGGAGACTGCCCACAC NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCC GTGGGCAGTCTCCCGGCT NGG
421825 single nucleotide variant 11 118478105 118478105 G C GTCCTCAGGCACCTGGCAGC GCCAGGTGCCTG GTGGGCAGTCTCCCGGCT NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGG CACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGC CACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGCA CACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGC CCACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGG CCACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGCAG CACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGCA CCACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGCAGCCGGG CACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGC ACCACAGGCCTCAG NGG
859836 single nucleotide variant 11 118478129 118478129 A C TCCCGGCTGCCAGGTGCCTG GCACCTGGC CACCACAGGCCTCAG NGG
513437 single nucleotide variant 11 118478153 118478153 T G TCCCGGCTGCCAGGTGCCTG GCACCTGGC TATCTCAGCAATTAGTACAAACACCACAGTCCTCAG NGG
513437 single nucleotide variant 11 118478153 118478153 T G TCCCGGCTGCCAGGTGCCTG GCACCTGGC GCTTATCTCAGCAATTAGTACAAACACCACAGTCCTCAG NGG
513437 single nucleotide variant 11 118478153 118478153 T G TCCCGGCTGCCAGGTGCCTG GCACCTGGC GGCTTATCTCAGCAATTAGTACAAACACCACAGTCCTCAG NGG
513437 single nucleotide variant 11 118478153 118478153 T G TCCCGGCTGCCAGGTGCCTG GCACCTGGC TTATCTCAGCAATTAGTACAAACACCACAGTCCTCAG NGG
513437 single nucleotide variant 11 118478153 118478153 T G TCCCGGCTGCCAGGTGCCTG GCACCTGGC GGGCTTATCTCAGCAATTAGTACAAACACCACAGTCCTCAG NGG
513437 single nucleotide variant 11 118478153 118478153 T G TCCCGGCTGCCAGGTGCCTG GCACCTGGC TGGGCTTATCTCAGCAATTAGTACAAACACCACAGTCCTCAG NGG
513437 single nucleotide variant 11 118478153 118478153 T G TCCCGGCTGCCAGGTGCCTG GCACCTGGCA TATCTCAGCAATTAGTACAAACACCACAGTCCTCAG NGG
513437 single nucleotide variant 11 118478153 118478153 T G TCCCGGCTGCCAGGTGCCTG GCACCTGGC CTTATCTCAGCAATTAGTACAAACACCACAGTCCTCAG NGG
513437 single nucleotide variant 11 118478153 118478153 T G TCCCGGCTGCCAGGTGCCTG GCACCTGGCA GCTTATCTCAGCAATTAGTACAAACACCACAGTCCTCAG NGG
513437 single nucleotide variant 11 118478153 118478153 T G TGCCAGGTGCCTGAGGACTG TCCTCAGGCACC TATCTCAGCAATTAGTACAAACACCACAG NGG
425907 single nucleotide variant 11 118478189 118478189 A C AAGCAACCTTTATGGTTGAG AACCATAAAGGT GGTGGTCGCAATATAAAGACGCAGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
425907 single nucleotide variant 11 118478189 118478189 A C AAGCAACCTTTATGGTTGAG AACCATAAAGGT GTGGTCGCAATATAAAGACGCAGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
425907 single nucleotide variant 11 118478189 118478189 A C AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GGTGGTCGCAATATAAAGACGCAGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
425907 single nucleotide variant 11 118478189 118478189 A C AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GTGGTCGCAATATAAAGACGCAGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
425907 single nucleotide variant 11 118478189 118478189 A C AAGCAACCTTTATGGTTGAG AACCATAAAGGT TGGTCGCAATATAAAGACGCAGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
425907 single nucleotide variant 11 118478189 118478189 A C AAGCAACCTTTATGGTTGAG AACCATAAAGGTT TGGTCGCAATATAAAGACGCAGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
425907 single nucleotide variant 11 118478189 118478189 A C AAGCAACCTTTATGGTTGAG AACCATAAAGGT GGTCGCAATATAAAGACGCAGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
425907 single nucleotide variant 11 118478189 118478189 A C AAGCAACCTTTATGGTTGAG AACCATAAAGGTTG GGTGGTCGCAATATAAAGACGCAGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
425907 single nucleotide variant 11 118478189 118478189 A C AAGCAACCTTTATGGTTGAG AACCATAAAGGT GTCGCAATATAAAGACGCAGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
425907 single nucleotide variant 11 118478189 118478189 A C AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GGTCGCAATATAAAGACGCAGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264591 single nucleotide variant 11 118478192 118478192 A T AAGCAACCTTTATGGTTGAG AACCATAAAGGT GGTGGTCGCAATATAAAGAAGCTGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264591 single nucleotide variant 11 118478192 118478192 A T AAGCAACCTTTATGGTTGAG AACCATAAAGGT GTGGTCGCAATATAAAGAAGCTGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264591 single nucleotide variant 11 118478192 118478192 A T AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GGTGGTCGCAATATAAAGAAGCTGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264591 single nucleotide variant 11 118478192 118478192 A T AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GTGGTCGCAATATAAAGAAGCTGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264591 single nucleotide variant 11 118478192 118478192 A T AAGCAACCTTTATGGTTGAG AACCATAAAGGT TGGTCGCAATATAAAGAAGCTGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264591 single nucleotide variant 11 118478192 118478192 A T AAGCAACCTTTATGGTTGAG AACCATAAAGGTT TGGTCGCAATATAAAGAAGCTGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264591 single nucleotide variant 11 118478192 118478192 A T AAGCAACCTTTATGGTTGAG AACCATAAAGGT GGTCGCAATATAAAGAAGCTGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264591 single nucleotide variant 11 118478192 118478192 A T AAGCAACCTTTATGGTTGAG AACCATAAAGGTTG GGTGGTCGCAATATAAAGAAGCTGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264591 single nucleotide variant 11 118478192 118478192 A T AAGCAACCTTTATGGTTGAG AACCATAAAGGT GTCGCAATATAAAGAAGCTGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264591 single nucleotide variant 11 118478192 118478192 A T AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GGTCGCAATATAAAGAAGCTGTGCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
1177394 single nucleotide variant 11 118478195 118478195 G T AAGCAACCTTTATGGTTGAG AACCATAAAGGT GGTGGTCGCAATATAAAGAAGCAGTTCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
1177394 single nucleotide variant 11 118478195 118478195 G T AAGCAACCTTTATGGTTGAG AACCATAAAGGT GTGGTCGCAATATAAAGAAGCAGTTCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
1177394 single nucleotide variant 11 118478195 118478195 G T AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GGTGGTCGCAATATAAAGAAGCAGTTCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
1177394 single nucleotide variant 11 118478195 118478195 G T AAGCAACCTTTATGGTTGAG AACCATAAAGGT TGGTCGCAATATAAAGAAGCAGTTCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
1177394 single nucleotide variant 11 118478195 118478195 G T AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GTGGTCGCAATATAAAGAAGCAGTTCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
1177394 single nucleotide variant 11 118478195 118478195 G T AAGCAACCTTTATGGTTGAG AACCATAAAGGT GCAGTTCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
1177394 single nucleotide variant 11 118478195 118478195 G T AAGCAACCTTTATGGTTGAG AACCATAAAGGTT TGGTCGCAATATAAAGAAGCAGTTCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
1177394 single nucleotide variant 11 118478195 118478195 G T AAGCAACCTTTATGGTTGAG AACCATAAAGGT GGTCGCAATATAAAGAAGCAGTTCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
1177394 single nucleotide variant 11 118478195 118478195 G T AAGCAACCTTTATGGTTGAG AACCATAAAGGTTG GGTGGTCGCAATATAAAGAAGCAGTTCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
1177394 single nucleotide variant 11 118478195 118478195 G T AAGCAACCTTTATGGTTGAG AACCATAAAGGT GTCGCAATATAAAGAAGCAGTTCTGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264447 single nucleotide variant 11 118478197 118478197 T C AAGCAACCTTTATGGTTGAG AACCATAAAGGT AGTGCCGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264447 single nucleotide variant 11 118478197 118478197 T C AAGCAACCTTTATGGTTGAG AACCATAAAGGT GGTGGTCGCAATATAAAGAAGCAGTGCCGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264447 single nucleotide variant 11 118478197 118478197 T C AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GGTGGTCGCAATATAAAGAAGCAGTGCCGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264447 single nucleotide variant 11 118478197 118478197 T C AAGCAACCTTTATGGTTGAG AACCATAAAGGT GTGGTCGCAATATAAAGAAGCAGTGCCGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264447 single nucleotide variant 11 118478197 118478197 T C AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GTGGTCGCAATATAAAGAAGCAGTGCCGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264447 single nucleotide variant 11 118478197 118478197 T C AAGCAACCTTTATGGTTGAG AACCATAAAGGT TGGTCGCAATATAAAGAAGCAGTGCCGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264447 single nucleotide variant 11 118478197 118478197 T C AAGCAACCTTTATGGTTGAG AACCATAAAGGTT AGTGCCGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264447 single nucleotide variant 11 118478197 118478197 T C AAGCAACCTTTATGGTTGAG AACCATAAAGGT GCAGTGCCGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264447 single nucleotide variant 11 118478197 118478197 T C AAGCAACCTTTATGGTTGAG AACCATAAAGGTT TGGTCGCAATATAAAGAAGCAGTGCCGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
264447 single nucleotide variant 11 118478197 118478197 T C AAGCAACCTTTATGGTTGAG AACCATAAAGGT GGTCGCAATATAAAGAAGCAGTGCCGCAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
513719 single nucleotide variant 11 118478198 118478198 G A AAGCAACCTTTATGGTTGAG AACCATAAAGGT GTGCTACAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
513719 single nucleotide variant 11 118478198 118478198 G A AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GTGCTACAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
513719 single nucleotide variant 11 118478198 118478198 G A AAGCAACCTTTATGGTTGAG AACCATAAAGGT AGTGCTACAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
513719 single nucleotide variant 11 118478198 118478198 G A AAGCAACCTTTATGGTTGAG AACCATAAAGGT GGTGGTCGCAATATAAAGAAGCAGTGCTACAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
513719 single nucleotide variant 11 118478198 118478198 G A AAGCAACCTTTATGGTTGAG AACCATAAAGG GTGCTACAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
513719 single nucleotide variant 11 118478198 118478198 G A AAGCAACCTTTATGGTTGAG AACCATAAAGGT GTGGTCGCAATATAAAGAAGCAGTGCTACAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
513719 single nucleotide variant 11 118478198 118478198 G A AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GGTGGTCGCAATATAAAGAAGCAGTGCTACAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
513719 single nucleotide variant 11 118478198 118478198 G A AAGCAACCTTTATGGTTGAG AACCATAAAGGT TGGTCGCAATATAAAGAAGCAGTGCTACAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
513719 single nucleotide variant 11 118478198 118478198 G A AAGCAACCTTTATGGTTGAG AACCATAAAGGTT GTGGTCGCAATATAAAGAAGCAGTGCTACAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
513719 single nucleotide variant 11 118478198 118478198 G A AAGCAACCTTTATGGTTGAG AACCATAAAGGTTG GTGCTACAAGTAAGTGGGTGTTTCACTCTGAGATGTTGACCTCTC NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTCTGACATTTTCTCATCCT ATGAGAAAATGTCA TTCCTGGG NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTTAGCTTGCTTCTGCAGGT TGCAGAAGCA TTCCTGGGATGAGAAAATGTCAGAATCTACAATGGATGCCTTCCAAAGCCTACC NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTTAGCTTGCTTCTGCAGGT TGCAGAAGCAAGCT TTCCTGGGATGAGAAAATGTCAGAATCTACAATGGATGCCTTCCAAAGCCTACC NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTCTGACATTTTCTCATCCT ATGAGAAAATGTC TTCCTGGG NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTTAGCTTGCTTCTGCAGGT TGCAGAAGCAA TTCCTGGGATGAGAAAATGTCAGAATCTACAATGGATGCCTTCCAAAGCCTACC NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTTAGCTTGCTTCTGCAGGT TGCAGAAGCAAGC TTCCTGGGATGAGAAAATGTCAGAATCTACAATGGATGCCTTCCAAAGCCTACC NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTTAGCTTGCTTCTGCAGGT TGCAGAAGCA ATTCGTTGTTTTCCTGGGATGAGAAAATGTCAGAATCTACAATGGATGCCTTCCAAAGCCTACC NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTTAGCTTGCTTCTGCAGGT TGCAGAAGCA TTCGTTGTTTTCCTGGGATGAGAAAATGTCAGAATCTACAATGGATGCCTTCCAAAGCCTACC NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTTAGCTTGCTTCTGCAGGT TGCAGAAGCA TCGTTGTTTTCCTGGGATGAGAAAATGTCAGAATCTACAATGGATGCCTTCCAAAGCCTACC NGG
973777 single nucleotide variant 11 118480172 118480172 A G TTTAGCTTGCTTCTGCAGGT TGCAGAAGCAAG TTCCTGGGATGAGAAAATGTCAGAATCTACAATGGATGCCTTCCAAAGCCTACC NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACAT GGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACATT GGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACAT TGGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACA GGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACAT TTGGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACATT TGGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACATTT GGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACATT TTGGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACA TGGAAGGCATCCATTA NGG
791106 single nucleotide variant 11 118480196 118480196 C T GAAAATGTCAGAATCTACAA TAGATTCTGACATTTTC GGAAGGCATCCATTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTC AACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCT AACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCTGC AACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCTGC TAACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTC ACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTC TAACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCTGCA AACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCTGCAGG AACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCT TAACAACACTGCCTTTA NGG
481976 single nucleotide variant 11 118480240 118480240 T C TACCTGCAGAAGCAAGCTAA GCTTGCTTCTGCAGG TAACAACACTGCCTTTA NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAA CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCA CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAAG CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAAGA CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGC CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAAGAG CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAAGAGA CTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAAGA TCTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCA TCTAGTTAGAAACCTACC NGG
973778 single nucleotide variant 11 118481804 118481804 C T TCCTCTCTTGCTGATGGGGT CCATCAGCAA TCTAGTTAGAAACCTACC NGG
511891 single nucleotide variant 11 118481870 118481870 C T CCTGTTTGGATTCAGGCCCA GCCTGAATCC AGTAGTGAGCCTCCTCCATGAAAGCCCGTCGAGGAAAAGAGTGAAGAAGGGAATGTCTCGGCCCCTGG NGG
511891 single nucleotide variant 11 118481870 118481870 C T CCTGTTTGGATTCAGGCCCA GCCTGAATCCA AGTAGTGAGCCTCCTCCATGAAAGCCCGTCGAGGAAAAGAGTGAAGAAGGGAATGTCTCGGCCCCTGG NGG
511891 single nucleotide variant 11 118481870 118481870 C T CCTGTTTGGATTCAGGCCCA GCCTGAATCCAA AGTAGTGAGCCTCCTCCATGAAAGCCCGTCGAGGAAAAGAGTGAAGAAGGGAATGTCTCGGCCCCTGG NGG
511891 single nucleotide variant 11 118481870 118481870 C T CCTGTTTGGATTCAGGCCCA GCCTGAATCC GTAGTGAGCCTCCTCCATGAAAGCCCGTCGAGGAAAAGAGTGAAGAAGGGAATGTCTCGGCCCCTGG NGG
511891 single nucleotide variant 11 118481870 118481870 C T CCTGTTTGGATTCAGGCCCA GCCTGAATCCAAAC AGTAGTGAGCCTCCTCCATGAAAGCCCGTCGAGGAAAAGAGTGAAGAAGGGAATGTCTCGGCCCCTGG NGG
511891 single nucleotide variant 11 118481870 118481870 C T CCTGTTTGGATTCAGGCCCA GCCTGAATCCAA GTAGTGAGCCTCCTCCATGAAAGCCCGTCGAGGAAAAGAGTGAAGAAGGGAATGTCTCGGCCCCTGG NGG
511891 single nucleotide variant 11 118481870 118481870 C T CCTGTTTGGATTCAGGCCCA GCCTGAATCCA GTAGTGAGCCTCCTCCATGAAAGCCCGTCGAGGAAAAGAGTGAAGAAGGGAATGTCTCGGCCCCTGG NGG
511891 single nucleotide variant 11 118481870 118481870 C T CCTGTTTGGATTCAGGCCCA GCCTGAATCCAAA AGTAGTGAGCCTCCTCCATGAAAGCCCGTCGAGGAAAAGAGTGAAGAAGGGAATGTCTCGGCCCCTGG NGG
511891 single nucleotide variant 11 118481870 118481870 C T CCTGTTTGGATTCAGGCCCA GCCTGAATCCAAAC GTAGTGAGCCTCCTCCATGAAAGCCCGTCGAGGAAAAGAGTGAAGAAGGGAATGTCTCGGCCCCTGG NGG
511891 single nucleotide variant 11 118481870 118481870 C T CCTGTTTGGATTCAGGCCCA GCCTGAATCC TAGTGAGCCTCCTCCATGAAAGCCCGTCGAGGAAAAGAGTGAAGAAGGGAATGTCTCGGCCCCTGG NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGG AAAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGG AAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCA AAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCA AAAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATC AAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGGT AAAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATC AAAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGGT AAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGGTG AAAAGTAGCCTCCACCA NGG
264597 single nucleotide variant 11 118482071 118482071 C T CACTCACCTGATTCTGGTGG CCAGAATCAGGTG AAAAAGTAGCCTCCACCA NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGT CACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGG CACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGTG CACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGTG TCCTCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGTG CTCCTCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGTGG CTCCTCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGT TCCTCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGTGG TCCTCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGT TCACTCAGCTGAT NGG
495463 single nucleotide variant 11 118482093 118482093 G C CAGCCTCCACCACCAGAATC TCTGGTGGT CTCCTCACTCAGCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGT CACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGG CACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGTG CACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGTGG CACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGT TCACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGTGGA CACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGG TCACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGTG TCACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGT CTCACTCTCCTGAT NGG
677432 single nucleotide variant 11 118482094 118482094 T A CAGCCTCCACCACCAGAATC TCTGGTGGTGGAGG CACTCTCCTGAT NGG
963718 single nucleotide variant 11 118484889 118484889 G T GACCTTTCTCTCTCCACAGG GTGGAGAGAG TATAGGAACAGAAGTCAAGATTCCTAAGCCTCCCATCTACCACACATTTTCTGCTTCACAATCCTCCT NGG
963718 single nucleotide variant 11 118484889 118484889 G T GACCTTTCTCTCTCCACAGG GTGGAGAGAGA TATAGGAACAGAAGTCAAGATTCCTAAGCCTCCCATCTACCACACATTTTCTGCTTCACAATCCTCCT NGG
963718 single nucleotide variant 11 118484889 118484889 G T GACCTTTCTCTCTCCACAGG GTGGAGAGA TATAGGAACAGAAGTCAAGATTCCTAAGCCTCCCATCTACCACACATTTTCTGCTTCACAATCCTCCT NGG
963718 single nucleotide variant 11 118484889 118484889 G T GACCTTTCTCTCTCCACAGG GTGGAGAGAG ATAGGAACAGAAGTCAAGATTCCTAAGCCTCCCATCTACCACACATTTTCTGCTTCACAATCCTCCT NGG
963718 single nucleotide variant 11 118484889 118484889 G T GACCTTTCTCTCTCCACAGG GTGGAGAGAGA ATAGGAACAGAAGTCAAGATTCCTAAGCCTCCCATCTACCACACATTTTCTGCTTCACAATCCTCCT NGG
963718 single nucleotide variant 11 118484889 118484889 G T GACCTTTCTCTCTCCACAGG GTGGAGAGAGAA TATAGGAACAGAAGTCAAGATTCCTAAGCCTCCCATCTACCACACATTTTCTGCTTCACAATCCTCCT NGG
963718 single nucleotide variant 11 118484889 118484889 G T GACCTTTCTCTCTCCACAGG GTGGAGAGA ATAGGAACAGAAGTCAAGATTCCTAAGCCTCCCATCTACCACACATTTTCTGCTTCACAATCCTCCT NGG
963718 single nucleotide variant 11 118484889 118484889 G T GACCTTTCTCTCTCCACAGG GTGGAGAGAG TAGGAACAGAAGTCAAGATTCCTAAGCCTCCCATCTACCACACATTTTCTGCTTCACAATCCTCCT NGG
963718 single nucleotide variant 11 118484889 118484889 G T GACCTTTCTCTCTCCACAGG GTGGAGAGAGAA ATAGGAACAGAAGTCAAGATTCCTAAGCCTCCCATCTACCACACATTTTCTGCTTCACAATCCTCCT NGG
963718 single nucleotide variant 11 118484889 118484889 G T GACCTTTCTCTCTCCACAGG GTGGAGAGAGA TAGGAACAGAAGTCAAGATTCCTAAGCCTCCCATCTACCACACATTTTCTGCTTCACAATCCTCCT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGC GTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGC TGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGC TTGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCC TGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCC GTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCC TTGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCCC TGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAG GTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCCCT TGTGTATTACCAAGT NGG
415250 single nucleotide variant 11 118488624 118488624 G A GGAAGGGCTCACAACAGACT CTGTTGTGAGCCC GTGTATTACCAAGT NGG
372204 single nucleotide variant 11 118489816 118489816 C T AGTTTGGTCCCAGGCACTCA GTGCCTGGGAC AGTGCTGAAACAGCTATCACCCTGA NGG
372204 single nucleotide variant 11 118489816 118489816 C T AGTTTGGTCCCAGGCACTCA GTGCCTGGGAC AAGTGCTGAAACAGCTATCACCCTGA NGG
372204 single nucleotide variant 11 118489816 118489816 C T AGTTTGGTCCCAGGCACTCA GTGCCTGGGACC AGTGCTGAAACAGCTATCACCCTGA NGG
372204 single nucleotide variant 11 118489816 118489816 C T AGTTTGGTCCCAGGCACTCA GTGCCTGGGAC TAAGTGCTGAAACAGCTATCACCCTGA NGG
372204 single nucleotide variant 11 118489816 118489816 C T AGTTTGGTCCCAGGCACTCA GTGCCTGGGACC AAGTGCTGAAACAGCTATCACCCTGA NGG
372204 single nucleotide variant 11 118489816 118489816 C T AGTTTGGTCCCAGGCACTCA GTGCCTGGGAC ATAAGTGCTGAAACAGCTATCACCCTGA NGG
372204 single nucleotide variant 11 118489816 118489816 C T AGTTTGGTCCCAGGCACTCA GTGCCTGGGACC TAAGTGCTGAAACAGCTATCACCCTGA NGG
372204 single nucleotide variant 11 118489816 118489816 C T AGTTTGGTCCCAGGCACTCA GTGCCTGGGAC GCTGGAGTGTAATAAGTGCTGAAACAGCTATCACCCTGA NGG
372204 single nucleotide variant 11 118489816 118489816 C T AGTTTGGTCCCAGGCACTCA GTGCCTGGGAC TGGAGTGTAATAAGTGCTGAAACAGCTATCACCCTGA NGG
372204 single nucleotide variant 11 118489816 118489816 C T AGTTTGGTCCCAGGCACTCA GTGCCTGGGAC GGAGTGTAATAAGTGCTGAAACAGCTATCACCCTGA NGG
495702 single nucleotide variant 11 118490128 118490128 G C CCACCCTTTGCCTGGAGTTG CTCCAGGCA TTCTACATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCCACAA NGG
495702 single nucleotide variant 11 118490128 118490128 G C CCACCCTTTGCCTGGAGTTG CTCCAGGC TTCTACATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCCACAA NGG
495702 single nucleotide variant 11 118490128 118490128 G C CCACCCTTTGCCTGGAGTTG CTCCAGGCAA TTCTACATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCCACAA NGG
495702 single nucleotide variant 11 118490128 118490128 G C CCACCCTTTGCCTGGAGTTG CTCCAGGCAAAGG TTCTACATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCCACAA NGG
495702 single nucleotide variant 11 118490128 118490128 G C CCACCCTTTGCCTGGAGTTG CTCCAGGCA TTTCTACATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCCACAA NGG
495702 single nucleotide variant 11 118490128 118490128 G C CCACCCTTTGCCTGGAGTTG CTCCAGGCAAAGGG TTCTACATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCCACAA NGG
495702 single nucleotide variant 11 118490128 118490128 G C CCACCCTTTGCCTGGAGTTG CTCCAGGCAAA TTCTACATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCCACAA NGG
495702 single nucleotide variant 11 118490128 118490128 G C CCACCCTTTGCCTGGAGTTG CTCCAGGC TTTCTACATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCCACAA NGG
495702 single nucleotide variant 11 118490128 118490128 G C CCACCCTTTGCCTGGAGTTG CTCCAGGCAAAG TTCTACATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCCACAA NGG
495702 single nucleotide variant 11 118490128 118490128 G C CCACCCTTTGCCTGGAGTTG CTCCAGGCAA TTTCTACATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCCACAA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGC TGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGC GGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCT GGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCT TGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGC TTGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCT TTGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCTT GGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGC TTTGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCTT TGGGTATCTTTA NGG
362437 single nucleotide variant 11 118490250 118490250 G A TGCGCCAAGCTCTTTGCTAA GCAAAGAGCT TTTGGGTATCTTTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTAC GGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACC GGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACC CGGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACC TCGGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACCG GGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACCGGC GGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACC CTCGGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTAC CGGACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTAC GACTACCAGCCATTA NGG
611744 single nucleotide variant 11 118491912 118491912 T A CCTGCCGGTAGCGTAGCAAA GCTACGCTACC GACTACCAGCCATTA NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGAC GCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGAC GGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGAC TGGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACT GCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACT GGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACT TGGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACTT GCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACTT GGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGAC CTGGCAATGGGCTGCCAAGC NGG
535318 single nucleotide variant 11 118493055 118493055 A G GGGATTTAAGTCTGGAGGCT CTCCAGACTT TGGCAATGGGCTGCCAAGC NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCA AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTC AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAAG AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAAGT AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAAGTC AAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCA GAAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAAG GAAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTC GAAATTTAAAAAGCCAACA NGG
264455 single nucleotide variant 11 118494360 118494360 A T GAAGGACTTGACCATGCTGT GCATGGTCAA GAAATTTAAAAAGCCAACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA TAAAAAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCA AAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAAAAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAAAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA TTAAAAAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCAA AAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCA AAAGCCTACA NGG
976333 single nucleotide variant 11 118494369 118494369 A T GAAGGACTTGACCATGCTGT GCATGGTCA AAAAGCCTACA NGG
859837 single nucleotide variant 11 118495755 118495755 C T TTAAAGGAGGCTGCTCAGTG TGAGCAGCC ATGCTTAGTGGCAGGAGCGAGAGGAAAACAGCCACAC NGG
859837 single nucleotide variant 11 118495755 118495755 C T TTAAAGGAGGCTGCTCAGTG TGAGCAGCC TATGCTTAGTGGCAGGAGCGAGAGGAAAACAGCCACAC NGG
859837 single nucleotide variant 11 118495755 118495755 C T TTAAAGGAGGCTGCTCAGTG TGAGCAGCCTCCTT ATGCTTAGTGGCAGGAGCGAGAGGAAAACAGCCACAC NGG
859837 single nucleotide variant 11 118495755 118495755 C T TTAAAGGAGGCTGCTCAGTG TGAGCAGCCTCCT ATGCTTAGTGGCAGGAGCGAGAGGAAAACAGCCACAC NGG
859837 single nucleotide variant 11 118495755 118495755 C T TTAAAGGAGGCTGCTCAGTG TGAGCAGCCTCCTT TATGCTTAGTGGCAGGAGCGAGAGGAAAACAGCCACAC NGG
859837 single nucleotide variant 11 118495755 118495755 C T TTAAAGGAGGCTGCTCAGTG TGAGCAGCCT ATGCTTAGTGGCAGGAGCGAGAGGAAAACAGCCACAC NGG
859837 single nucleotide variant 11 118495755 118495755 C T TTAAAGGAGGCTGCTCAGTG TGAGCAGCC TTATGCTTAGTGGCAGGAGCGAGAGGAAAACAGCCACAC NGG
859837 single nucleotide variant 11 118495755 118495755 C T TTAAAGGAGGCTGCTCAGTG TGAGCAGCCTC ATGCTTAGTGGCAGGAGCGAGAGGAAAACAGCCACAC NGG
859837 single nucleotide variant 11 118495755 118495755 C T TTAAAGGAGGCTGCTCAGTG TGAGCAGCCTCCTTT ATGCTTAGTGGCAGGAGCGAGAGGAAAACAGCCACAC NGG
859837 single nucleotide variant 11 118495755 118495755 C T TTAAAGGAGGCTGCTCAGTG TGAGCAGCC ATTATGCTTAGTGGCAGGAGCGAGAGGAAAACAGCCACAC NGG
1244404 single nucleotide variant 11 118496275 118496275 C T TGTCTTCTATGCCTGGGGGT CCCAGGCA GGAGTTGAGAAGACAGTCCAGAGCTGAACCCACC NGG
1244404 single nucleotide variant 11 118496275 118496275 C T TGTCTTCTATGCCTGGGGGT CCCAGGCA AGGAGTTGAGAAGACAGTCCAGAGCTGAACCCACC NGG
1244404 single nucleotide variant 11 118496275 118496275 C T TGTCTTCTATGCCTGGGGGT CCCAGGCA TAGGAGTTGAGAAGACAGTCCAGAGCTGAACCCACC NGG
1244404 single nucleotide variant 11 118496275 118496275 C T TGTCTTCTATGCCTGGGGGT CCCAGGCA ATAGGAGTTGAGAAGACAGTCCAGAGCTGAACCCACC NGG
1244404 single nucleotide variant 11 118496275 118496275 C T TGTCTTCTATGCCTGGGGGT CCCAGGCA GATAGGAGTTGAGAAGACAGTCCAGAGCTGAACCCACC NGG
1244404 single nucleotide variant 11 118496275 118496275 C T TGTCTTCTATGCCTGGGGGT CCCAGGCA TGATAGGAGTTGAGAAGACAGTCCAGAGCTGAACCCACC NGG
1244404 single nucleotide variant 11 118496275 118496275 C T TGTCTTCTATGCCTGGGGGT CCCAGGCAT GGAGTTGAGAAGACAGTCCAGAGCTGAACCCACC NGG
1244404 single nucleotide variant 11 118496275 118496275 C T TTGTCTTCTATGCCTGGGGG CCAGGCAT GGAGTTGAGAAGACAGTCCAGAGCTGAACCCACCC NGG
1244404 single nucleotide variant 11 118496275 118496275 C T TTGTCTTCTATGCCTGGGGG CCAGGCAT AGGAGTTGAGAAGACAGTCCAGAGCTGAACCCACCC NGG
1244404 single nucleotide variant 11 118496275 118496275 C T TGTCTTCTATGCCTGGGGGT CCCAGGCA CTGATAGGAGTTGAGAAGACAGTCCAGAGCTGAACCCACC NGG
424354 single nucleotide variant 11 118498369 118498369 G A TGTGAGACAGCAACCCACGG TGGGTTGCTGTC TTTTAAAGATGTGAATTCTGCCAAAAGCCAGGAGCCACCG NGG
424354 single nucleotide variant 11 118498369 118498369 G A TGTGAGACAGCAACCCACGG TGGGTTGCTGTCTC TTTTAAAGATGTGAATTCTGCCAAAAGCCAGGAGCCACCG NGG
424354 single nucleotide variant 11 118498369 118498369 G A GGATGTGAGACAGCAACCCA GTTGCTGTCTC TTTTAAAGATGTGAATTCTGCCAAAAGCCAGGAGCCACCGTGG NGG
424354 single nucleotide variant 11 118498369 118498369 G A TGTGAGACAGCAACCCACGG TGGGTTGCTGTCT TTTTAAAGATGTGAATTCTGCCAAAAGCCAGGAGCCACCG NGG
424354 single nucleotide variant 11 118498369 118498369 G A GGATGTGAGACAGCAACCCA GTTGCTGTCTCA TTTTAAAGATGTGAATTCTGCCAAAAGCCAGGAGCCACCGTGG NGG
424354 single nucleotide variant 11 118498369 118498369 G A TGTGAGACAGCAACCCACGG TGGGTTGCTGTCTCA TTTTAAAGATGTGAATTCTGCCAAAAGCCAGGAGCCACCG NGG
424354 single nucleotide variant 11 118498369 118498369 G A GGATGTGAGACAGCAACCCA GTTGCTGTCTCAC TTTTAAAGATGTGAATTCTGCCAAAAGCCAGGAGCCACCGTGG NGG
424354 single nucleotide variant 11 118498369 118498369 G A GGATGTGAGACAGCAACCCA GTTGCTGTCTCACA TTTTAAAGATGTGAATTCTGCCAAAAGCCAGGAGCCACCGTGG NGG
424354 single nucleotide variant 11 118498369 118498369 G A TGTGAGACAGCAACCCACGG TGGGTTGCTGTC TTTTTAAAGATGTGAATTCTGCCAAAAGCCAGGAGCCACCG NGG
424354 single nucleotide variant 11 118498369 118498369 G A GGATGTGAGACAGCAACCCA GTTGCTGTC TTTTAAAGATGTGAATTCTGCCAAAAGCCAGGAGCCACCGTGG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAAC GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAAC TGTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACT GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACTG GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACTGTG GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACTGTGT GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACT TGTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACTGT GTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAACTG TGTGTTCCTGAG NGG
975304 single nucleotide variant 11 118498454 118498454 C T AAAGACACAGTTCTTGGCTC CCAAGAAC TGTTCCTGAG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGAT AAGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGAT AGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGATT AAGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGATT AGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGAT GTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGATT GTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGAT AAAGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGA AAGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGATTT AAGTATATTGCCAATG NGG
1087067 single nucleotide variant 11 118498502 118498502 C T TGATCAAATCCCGATGTCGT ACATCGGGA AGTATATTGCCAATG NGG
215425 single nucleotide variant 11 118501681 118501681 C G TGAGGAGGTCGGTCTGGTGA CCAGACCG TTCATGAAAAGAGAGTCAAAACACAGCTGAAATTATAAGTCCTCCATCA NGG
215425 single nucleotide variant 11 118501681 118501681 C G TGAGGAGGTCGGTCTGGTGA CCAGACCG GTTCATGAAAAGAGAGTCAAAACACAGCTGAAATTATAAGTCCTCCATCA NGG
215425 single nucleotide variant 11 118501681 118501681 C G TGAGGAGGTCGGTCTGGTGA CCAGACCG AGTTCATGAAAAGAGAGTCAAAACACAGCTGAAATTATAAGTCCTCCATCA NGG
215425 single nucleotide variant 11 118501681 118501681 C G TGAGGAGGTCGGTCTGGTGA CCAGACCG AAGTTCATGAAAAGAGAGTCAAAACACAGCTGAAATTATAAGTCCTCCATCA NGG
215425 single nucleotide variant 11 118501681 118501681 C G TGAGGAGGTCGGTCTGGTGA CCAGACCGA TTCATGAAAAGAGAGTCAAAACACAGCTGAAATTATAAGTCCTCCATCA NGG
215425 single nucleotide variant 11 118501681 118501681 C G TGAGGAGGTCGGTCTGGTGA CCAGACCG AAAGTTCATGAAAAGAGAGTCAAAACACAGCTGAAATTATAAGTCCTCCATCA NGG
215425 single nucleotide variant 11 118501681 118501681 C G TGAGGAGGTCGGTCTGGTGA CCAGACCGA GTTCATGAAAAGAGAGTCAAAACACAGCTGAAATTATAAGTCCTCCATCA NGG
215425 single nucleotide variant 11 118501681 118501681 C G TGAGGAGGTCGGTCTGGTGA CCAGACCG GAAAGTTCATGAAAAGAGAGTCAAAACACAGCTGAAATTATAAGTCCTCCATCA NGG
215425 single nucleotide variant 11 118501681 118501681 C G TGAGGAGGTCGGTCTGGTGA CCAGACCG AGAAAGTTCATGAAAAGAGAGTCAAAACACAGCTGAAATTATAAGTCCTCCATCA NGG
215425 single nucleotide variant 11 118501681 118501681 C G TGAGGAGGTCGGTCTGGTGA CCAGACCGA AGTTCATGAAAAGAGAGTCAAAACACAGCTGAAATTATAAGTCCTCCATCA NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGTAA CTGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGG CTGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGTAA GGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGTAA TGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGTA CTGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGT CTGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGG TGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGG GGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGT TGGCTGTTGACCGTTG NGG
444732 single nucleotide variant 11 118501839 118501839 C T CTTTTACCTGCAGAAGGCAA CCTTCTGCAGGTAAA GGCTGTTGACCGTTG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGAT GCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGA GCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGA ATGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGAT ATGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGA TGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGAT TGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGA AATGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGG GCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGAT AATGCTTCAAAGTCCAGAG NGG
514620 single nucleotide variant 11 118502463 118502463 C T GGTGATCCTTTACTCTCCTC GAGAGTAAAGGATC GCTTCAAAGTCCAGAG NGG
408286 single nucleotide variant 11 118502656 118502656 C A AAAGTAGTTGATCATGTCTT ACATGATCAACTAC GTACTTTAATTCAGTGGCCCTAAG NGG
408286 single nucleotide variant 11 118502656 118502656 C A AAAGTAGTTGATCATGTCTT ACATGATCAACT GTACTTTAATTCAGTGGCCCTAAG NGG
408286 single nucleotide variant 11 118502656 118502656 C A AAAGTAGTTGATCATGTCTT ACATGATCAACTAC AAACTAGTACTTTAATTCAGTGGCCCTAAG NGG
408286 single nucleotide variant 11 118502656 118502656 C A AAAGTAGTTGATCATGTCTT ACATGATCAACTAC AACTAGTACTTTAATTCAGTGGCCCTAAG NGG
408286 single nucleotide variant 11 118502656 118502656 C A AAAGTAGTTGATCATGTCTT ACATGATCAACTA GTACTTTAATTCAGTGGCCCTAAG NGG
408286 single nucleotide variant 11 118502656 118502656 C A AAAGTAGTTGATCATGTCTT ACATGATCAACTAC AGTACTTTAATTCAGTGGCCCTAAG NGG
408286 single nucleotide variant 11 118502656 118502656 C A AAAGTAGTTGATCATGTCTT ACATGATCAACTAC TAAACTAGTACTTTAATTCAGTGGCCCTAAG NGG
408286 single nucleotide variant 11 118502656 118502656 C A AAAGTAGTTGATCATGTCTT ACATGATCAACT AGTACTTTAATTCAGTGGCCCTAAG NGG
408286 single nucleotide variant 11 118502656 118502656 C A AAAGTAGTTGATCATGTCTT ACATGATCAACTAC ACTAGTACTTTAATTCAGTGGCCCTAAG NGG
408286 single nucleotide variant 11 118502656 118502656 C A AAAGTAGTTGATCATGTCTT ACATGATCAACTA AGTACTTTAATTCAGTGGCCCTAAG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGGA GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGGA GGTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCA GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAA GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGG GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAAT GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGG GGTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGGAG GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAA GTCTCAATCATTCCTTTG NGG
45750 single nucleotide variant 11 118503036 118503036 C T ACCTCCATTTGAGAGGGCAA CCCTCTCAAATGGAGG GTCTCAATCATTCCTTTG NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACC AATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTAC AATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACCCA AATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACCCAA AATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACC GAATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACCC AATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACC GGAATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTAC ATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTAC GAATGATCGAGACTAACA NGG
511895 single nucleotide variant 11 118503042 118503042 C T ATTGGGTAGAATCTGTGTGT CACAGATTCTACCCAAT AATGATCGAGACTAACA NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAA GAGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACA GAGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAAT GAGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACA GTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAA GTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAA AGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAA TGAGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACA AGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACA TGAGTATATGGGCCAATG NGG
444733 single nucleotide variant 11 118503330 118503330 C T AAACATTGTTACATGGTCGT ACCATGTAACAATG GAGTATATGGGCCAATG NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGC CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGCCATCTGG CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGCCATCTG CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T AGATGGCCCCAAACCTCAGG GAGGTTTGGGG CCATCCTACT NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGCCATCTGGA CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T AGATGGCCCCAAACCTCAGG GAGGTTTGGGG CATCCTACT NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGCCATCTGGAA CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T AGATGGCCCCAAACCTCAGG GAGGTTTGGG CCATCCTACT NGG
168858 single nucleotide variant 11 118503723 118503723 G T TCCAGATGGCCCCAAACCTC GTTTGGGGCC CATCCTACTGAG NGG
168858 single nucleotide variant 11 118503723 118503723 G T AGATGGCCCCAAACCTCAGG GAGGTTTGGG CATCCTACT NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAG CTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT GCTGATCTCTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT AGCTGATCTCTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT CTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT TGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT GATCTCTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGTTG AGCTGATCTCTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAG TGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGT TGATCTCTTGCCTCAC NGG
966971 single nucleotide variant 11 118503867 118503867 C T AGCTCAACTGGGAAGAAGCG TTCTTCCCAGTT GCTGATCTCTTGCCTCAC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGA CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAA CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAG CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAAA CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAAAT CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGA CCAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAA CCAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAA GCCAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAAATC CAGTCATTCCTCTC NGG
168859 single nucleotide variant 11 118503987 118503987 C T AGTGATTTCTTCAGGTGGAG CACCTGAAGAAA CCAGTCATTCCTCTC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCT TGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGC TGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCTTTGGG TGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCT TTGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCTTTGG TGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGC TTGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCTT TGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCTTTGGGT TGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCTTTGGG TTGTACAAAAGAATACTCCATCC NGG
371262 single nucleotide variant 11 118504462 118504462 T A TCACCCAAAGCCTGCATGGA ATGCAGGCT ATGGACTTTGTACAAAAGAATACTCCATCC NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGA CTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAA CTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAG CTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAAG CTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGA TGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAAGT CTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAA TGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGA ACTGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAAG TGTTCCCATCT NGG
415251 single nucleotide variant 11 118505025 118505025 C T CACATACTTCTGGTTCTGGA AGAACCAGAA ACTGTTCCCATCT NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCC CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCC CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCA CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCC CCAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCC CCAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCAA CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCA CCAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCAAT CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCAATTCTA CAGAACTAGAA NGG
536806 single nucleotide variant 11 118505031 118505031 C T TAGAATTGGGCACATACTTC GTATGTGCCCAA CCAGAACTAGAA NGG
1173814 single nucleotide variant 11 118505328 118505328 C T GGTGGTCTCACCCTTACCAC GTAAGGGTGAGACC AGATTAAGAAGTTGGCAAGCTTGGATTTAGTCCTGTG NGG
1173814 single nucleotide variant 11 118505328 118505328 C T GGTGGTCTCACCCTTACCAC GTAAGGGTGAGACCA AGATTAAGAAGTTGGCAAGCTTGGATTTAGTCCTGTG NGG
1173814 single nucleotide variant 11 118505328 118505328 C T GGTGGTCTCACCCTTACCAC GTAAGGGTGAGAC AGATTAAGAAGTTGGCAAGCTTGGATTTAGTCCTGTG NGG
1173814 single nucleotide variant 11 118505328 118505328 C T GGTGGTCTCACCCTTACCAC GTAAGGGTGAGACC AAGATTAAGAAGTTGGCAAGCTTGGATTTAGTCCTGTG NGG
1173814 single nucleotide variant 11 118505328 118505328 C T GGTGGTCTCACCCTTACCAC GTAAGGGTGAGACCA AAGATTAAGAAGTTGGCAAGCTTGGATTTAGTCCTGTG NGG
1173814 single nucleotide variant 11 118505328 118505328 C T GGTGGTCTCACCCTTACCAC GTAAGGGTGAGAC AAGATTAAGAAGTTGGCAAGCTTGGATTTAGTCCTGTG NGG
1173814 single nucleotide variant 11 118505328 118505328 C T GGTGGTCTCACCCTTACCAC GTAAGGGTGAGA AGATTAAGAAGTTGGCAAGCTTGGATTTAGTCCTGTG NGG
1173814 single nucleotide variant 11 118505328 118505328 C T GGTGGTCTCACCCTTACCAC GTAAGGGTGAGACC AAAGATTAAGAAGTTGGCAAGCTTGGATTTAGTCCTGTG NGG
1173814 single nucleotide variant 11 118505328 118505328 C T GGTGGTCTCACCCTTACCAC GTAAGGGTGAGACCA AAAGATTAAGAAGTTGGCAAGCTTGGATTTAGTCCTGTG NGG
1173814 single nucleotide variant 11 118505328 118505328 C T GGTGGTCTCACCCTTACCAC GTAAGGGTGAGAC AAAGATTAAGAAGTTGGCAAGCTTGGATTTAGTCCTGTG NGG
514621 single nucleotide variant 11 118505586 118505586 C T AATGTTTGAAGGGGTACTAG GTACCCCT CAGACCTGAAAGAATAAAAAACTTGCTCCCTCTA NGG
514621 single nucleotide variant 11 118505586 118505586 C T AATGTTTGAAGGGGTACTAG GTACCCCT ACAGACCTGAAAGAATAAAAAACTTGCTCCCTCTA NGG
514621 single nucleotide variant 11 118505586 118505586 C T AATGTTTGAAGGGGTACTAG GTACCCCT TACAGACCTGAAAGAATAAAAAACTTGCTCCCTCTA NGG
514621 single nucleotide variant 11 118505586 118505586 C T AATGTTTGAAGGGGTACTAG GTACCCCT AGACCTGAAAGAATAAAAAACTTGCTCCCTCTA NGG
514621 single nucleotide variant 11 118505586 118505586 C T AATGTTTGAAGGGGTACTAG GTACCCCT CTACAGACCTGAAAGAATAAAAAACTTGCTCCCTCTA NGG
514621 single nucleotide variant 11 118505586 118505586 C T AATGTTTGAAGGGGTACTAG GTACCCCT CGTCTACAGACCTGAAAGAATAAAAAACTTGCTCCCTCTA NGG
514621 single nucleotide variant 11 118505586 118505586 C T AATGTTTGAAGGGGTACTAG GTACCCCT GTCTACAGACCTGAAAGAATAAAAAACTTGCTCCCTCTA NGG
514621 single nucleotide variant 11 118505586 118505586 C T AATGTTTGAAGGGGTACTAG GTACCCCT TCGTCTACAGACCTGAAAGAATAAAAAACTTGCTCCCTCTA NGG
514621 single nucleotide variant 11 118505586 118505586 C T AATGTTTGAAGGGGTACTAG GTACCCCT TCTACAGACCTGAAAGAATAAAAAACTTGCTCCCTCTA NGG
514621 single nucleotide variant 11 118505586 118505586 C T AATGTTTGAAGGGGTACTAG GTACCCCT CTCGTCTACAGACCTGAAAGAATAAAAAACTTGCTCCCTCTA NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAAC TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACA TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACAT TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCA TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAAC ATACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAA TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACA ATACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACATCA TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACATC TACTTAATCTCACCGAAC NGG
963721 single nucleotide variant 11 118505731 118505731 C A TTATGATGTTGGGGACAGTT TGTCCCCAACAT ATACTTAATCTCACCGAAC NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTAC GCTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTA TTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGT TTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTA GCTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTACC GCTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTAC TGCTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTAC TTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGT GCTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTAC CTTATTCAGCCAATA NGG
408287 single nucleotide variant 11 118506031 118506031 C G TTGCTTGGTACCCCAGATAT TCTGGGGTACC TGCTTATTCAGCCAATA NGG
444735 single nucleotide variant 11 118506063 118506063 C T GAACTTGGCGGTAAAGCCAC GCTTTACCGCC GCCAGTAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
444735 single nucleotide variant 11 118506063 118506063 C T GAACTTGGCGGTAAAGCCAC GCTTTACCGCC AGCCAGTAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
444735 single nucleotide variant 11 118506063 118506063 C T GAACTTGGCGGTAAAGCCAC GCTTTACCGCC GCTAGCCAGTAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
444735 single nucleotide variant 11 118506063 118506063 C T GAACTTGGCGGTAAAGCCAC GCTTTACCGCC AGCTAGCCAGTAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
444735 single nucleotide variant 11 118506063 118506063 C T GAACTTGGCGGTAAAGCCAC GCTTTACCGCC TAGCCAGTAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
444735 single nucleotide variant 11 118506063 118506063 C T CAGGCTGGTCCTGAATCCCC GATTCAGGACCAG AGCCAGTAGAGCCTGGG NGG
444735 single nucleotide variant 11 118506063 118506063 C T CAGGCTGGTCCTGAATCCCC GATTCAGGACC TAGCCAGTAGAGCCTGGG NGG
444735 single nucleotide variant 11 118506063 118506063 C T CAGGCTGGTCCTGAATCCCC GATTCAGGACCAG TAGCCAGTAGAGCCTGGG NGG
444735 single nucleotide variant 11 118506063 118506063 C T CAGGCTGGTCCTGAATCCCC GATTCAGGACCA TAGCCAGTAGAGCCTGGG NGG
444735 single nucleotide variant 11 118506063 118506063 C T GAACTTGGCGGTAAAGCCAC GCTTTACCGCCA GCCAGTAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGAC AAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGAC CAAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGAC GCCAAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGAC CCAAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGACA AAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GGGGATTCAGGACCAGCCTG GCTGGTCC GTGGAAACATTCCTTAACTTGGCGGTAAAGCCACAG NGG
259977 single nucleotide variant 11 118506109 118506109 C A GGGGATTCAGGACCAGCCTG GCTGGTCC TGTGGAAACATTCCTTAACTTGGCGGTAAAGCCACAG NGG
259977 single nucleotide variant 11 118506109 118506109 C A GGGGATTCAGGACCAGCCTG GCTGGTCC TGGAAACATTCCTTAACTTGGCGGTAAAGCCACAG NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGAC CGCCAAGTTAAGGAATGTTTCCACAA NGG
259977 single nucleotide variant 11 118506109 118506109 C A GTCTGTGATGTCCCCAGTTG CTGGGGACA CAAGTTAAGGAATGTTTCCACAA NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGAC CACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACT CACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACTG CACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGAC ACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACTG ACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACT ACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGAC CCACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACT CCACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACTGC CACACTACTTCT NGG
975308 single nucleotide variant 11 118507590 118507590 G T CGTGGAGCAGTCCTCCCAGA GGGAGGACTG CCACACTACTTCT NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACA AATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACAG AATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACAG ATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCAC AATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACA ATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A TGAAACAGGGCTTCTGCTGA GCAGAAGCC TGAAGATGAGTGGATTAAATCAGGTTGACCCATCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACA TAATCCACTCATCTTCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A TGAAACAGGGCTTCTGCTGA GCAGAAGCC TTGAAGATGAGTGGATTAAATCAGGTTGACCCATCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A TGAAACAGGGCTTCTGCTGA GCAGAAGC TGAAGATGAGTGGATTAAATCAGGTTGACCCATCA NGG
439883 single nucleotide variant 11 118510119 118510119 G A ATCTGTGCAGAAAGTATTGA ATACTTTCTGCACAG TAATCCACTCATCTTCA NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAAT GTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAA GTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAAT TCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAA TCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAAT TGTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAATA GTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAA TGTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAAATA TCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAA GTCAATCACTTCCAGGC NGG
207817 single nucleotide variant 11 118511963 118511963 C G TTTATTTCCTTTCAGATGCC ATCTGAAAGGAA TCAATCACTTCCAGGC NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGACT TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGAC TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGA TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAAT TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATG TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGAC TTGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGACT TTGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAATGA TTGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T GTCATTGACAGATAAAGTCC CTTTATCTGTCAA TGATCAAGCTTCCTGGA NGG
514622 single nucleotide variant 11 118511989 118511989 C T AAATGAGAGCTGCTTTAGGC TAAAGCAGCTCTCA AAGCTTGATCAAATGCCCGCC NGG
421829 single nucleotide variant 11 118519616 118519616 A G GACTGCGCTCCTCACTTCCC AAGTGAGGAGC ACACCCAGAAGAATCAGAAGCACCAGGG NGG
421829 single nucleotide variant 11 118519616 118519616 A G GACTGCGCTCCTCACTTCCC AAGTGAGGAGC AACACCCAGAAGAATCAGAAGCACCAGGG NGG
421829 single nucleotide variant 11 118519616 118519616 A G GACTGCGCTCCTCACTTCCC AAGTGAGGAGCG ACACCCAGAAGAATCAGAAGCACCAGGG NGG
421829 single nucleotide variant 11 118519616 118519616 A G GACTGCGCTCCTCACTTCCC AAGTGAGGAGC TAACACCCAGAAGAATCAGAAGCACCAGGG NGG
421829 single nucleotide variant 11 118519616 118519616 A G GACTGCGCTCCTCACTTCCC AAGTGAGGAGCG AACACCCAGAAGAATCAGAAGCACCAGGG NGG
421829 single nucleotide variant 11 118519616 118519616 A G GACTGCGCTCCTCACTTCCC AAGTGAGGAGCG TAACACCCAGAAGAATCAGAAGCACCAGGG NGG
421829 single nucleotide variant 11 118519616 118519616 A G GACTGCGCTCCTCACTTCCC AAGTGAGGAGC GTTAACACCCAGAAGAATCAGAAGCACCAGGG NGG
421829 single nucleotide variant 11 118519616 118519616 A G GACTGCGCTCCTCACTTCCC AAGTGAGGAGC TTAACACCCAGAAGAATCAGAAGCACCAGGG NGG
421829 single nucleotide variant 11 118519616 118519616 A G GACTGCGCTCCTCACTTCCC AAGTGAGGAG ACACCCAGAAGAATCAGAAGCACCAGGG NGG
421829 single nucleotide variant 11 118519616 118519616 A G GACTGCGCTCCTCACTTCCC AAGTGAGGAGC CGTTAACACCCAGAAGAATCAGAAGCACCAGGG NGG
363661 single nucleotide variant 11 118519701 118519701 C T CATTGGCCTCCTCTGGCTTG GCCAGAGGAGG GCACTGTTGAAATTACAAATTCCGTTTCCACAA NGG
363661 single nucleotide variant 11 118519701 118519701 C T CATTGGCCTCCTCTGGCTTG GCCAGAGGAGG AGCACTGTTGAAATTACAAATTCCGTTTCCACAA NGG
363661 single nucleotide variant 11 118519701 118519701 C T CATTGGCCTCCTCTGGCTTG GCCAGAGGAGGC GCACTGTTGAAATTACAAATTCCGTTTCCACAA NGG
363661 single nucleotide variant 11 118519701 118519701 C T CATTGGCCTCCTCTGGCTTG GCCAGAGGAGGC AGCACTGTTGAAATTACAAATTCCGTTTCCACAA NGG
363661 single nucleotide variant 11 118519701 118519701 C T CATTGGCCTCCTCTGGCTTG GCCAGAGGAGGC TGGTGCCAAGCACTGTTGAAATTACAAATTCCGTTTCCACAA NGG
363661 single nucleotide variant 11 118519701 118519701 C T CATTGGCCTCCTCTGGCTTG GCCAGAGGAGG TGGTGCCAAGCACTGTTGAAATTACAAATTCCGTTTCCACAA NGG
363661 single nucleotide variant 11 118519701 118519701 C T CATTGGCCTCCTCTGGCTTG GCCAGAGGAGGCC TGGTGCCAAGCACTGTTGAAATTACAAATTCCGTTTCCACAA NGG
363661 single nucleotide variant 11 118519701 118519701 C T CATTGGCCTCCTCTGGCTTG GCCAGAGGAGG AAGCACTGTTGAAATTACAAATTCCGTTTCCACAA NGG
363661 single nucleotide variant 11 118519701 118519701 C T CATTGGCCTCCTCTGGCTTG GCCAGAGGAGGCC GCACTGTTGAAATTACAAATTCCGTTTCCACAA NGG
363661 single nucleotide variant 11 118519701 118519701 C T CATTGGCCTCCTCTGGCTTG GCCAGAGGAGGCC AGCACTGTTGAAATTACAAATTCCGTTTCCACAA NGG
973768 Insertion 11 118436678 118436679 T TA GCCGCGGCCGCCACAGCCGG GCTGTGGCGGC GCCCCCCTACCCCCCCG NGG
973768 Insertion 11 118436678 118436679 T TA GCCGCGGCCGCCACAGCCGG GCTGTGGCGGC CGCCCCCCTACCCCCCCG NGG
973768 Insertion 11 118436678 118436679 T TA GCCGCGGCCGCCACAGCCGG GCTGTGGCGGC GCGCCCCCCTACCCCCCCG NGG
973768 Insertion 11 118436678 118436679 T TA GCCGCGGCCGCCACAGCCGG GCTGTGGCGGC GGCGCCCCCCTACCCCCCCG NGG
973768 Insertion 11 118436678 118436679 T TA GCCGCGGCCGCCACAGCCGG GCTGTGGCGG GCCCCCCTACCCCCCCG NGG
973768 Insertion 11 118436678 118436679 T TA GCCGCGGCCGCCACAGCCGG GCTGTGGCGG CCCCCCTACCCCCCCG NGG
973768 Insertion 11 118436678 118436679 T TA GCCGCGGCCGCCACAGCCGG GCTGTGGCGGC CCCCCCTACCCCCCCG NGG
973768 Insertion 11 118436678 118436679 T TA GCCGCGGCCGCCACAGCCGG GCTGTGGCGGCC GCCCCCCTACCCCCCCG NGG
973768 Insertion 11 118436678 118436679 T TA GCCGCGGCCGCCACAGCCGG GCTGTGGCGGC GGGCGCCCCCCTACCCCCCCG NGG
973768 Insertion 11 118436678 118436679 T TA GCCGCGGCCGCCACAGCCGG GCTGTGGCGG CCCCTACCCCCCCG NGG
434105 Insertion 11 118471761 118471762 A AT CTTGATCTTATCTCCAGATT CTGGAGATAAGAT AATAATATCAGAGACCAAAT NGG
434105 Insertion 11 118471761 118471762 A AT CTTGATCTTATCTCCAGATT CTGGAGATAAGATC AATAATATCAGAGACCAAAT NGG
434105 Insertion 11 118471761 118471762 A AT CTTGATCTTATCTCCAGATT CTGGAGATAAGA AATAATATCAGAGACCAAAT NGG
434105 Insertion 11 118471761 118471762 A AT CTTGATCTTATCTCCAGATT CTGGAGATAAGATC AAATAATATCAGAGACCAAAT NGG
434105 Insertion 11 118471761 118471762 A AT CTTGATCTTATCTCCAGATT CTGGAGATAAGAT AAATAATATCAGAGACCAAAT NGG
434105 Insertion 11 118471761 118471762 A AT CTTGATCTTATCTCCAGATT CTGGAGATAAGA AAATAATATCAGAGACCAAAT NGG
434105 Insertion 11 118471761 118471762 A AT CTTGATCTTATCTCCAGATT CTGGAGATAAGATCA AATAATATCAGAGACCAAAT NGG
434105 Insertion 11 118471761 118471762 A AT CTTGATCTTATCTCCAGATT CTGGAGATAAG AATAATATCAGAGACCAAAT NGG
434105 Insertion 11 118471761 118471762 A AT CTTGATCTTATCTCCAGATT CTGGAGATAAGATC TAAATAATATCAGAGACCAAAT NGG
434105 Insertion 11 118471761 118471762 A AT CTTGATCTTATCTCCAGATT CTGGAGATAAGATCA AAATAATATCAGAGACCAAAT NGG
805093 Insertion 11 118472093 118472094 A AC GAATTAATGAGGAGACCCGA GGTCTCCTCAT AAGGACTAAAGACCCCTTCG NGG
805093 Insertion 11 118472093 118472094 A AC GAATTAATGAGGAGACCCGA GGTCTCCTC AAGGACTAAAGACCCCTTCG NGG
805093 Insertion 11 118472093 118472094 A AC GAATTAATGAGGAGACCCGA GGTCTCCTCA AAGGACTAAAGACCCCTTCG NGG
805093 Insertion 11 118472093 118472094 A AC ATTAATGAGGAGACCCGAAG CGGGTCTCCTC AAGGACTAAAGACCCCTT NGG
805093 Insertion 11 118472093 118472094 A AC ATTAATGAGGAGACCCGAAG CGGGTCTCCTCAT AAGGACTAAAGACCCCTT NGG
805093 Insertion 11 118472093 118472094 A AC ATTAATGAGGAGACCCGAAG CGGGTCTCCTCA AAGGACTAAAGACCCCTT NGG
805093 Insertion 11 118472093 118472094 A AC AATTAATGAGGAGACCCGAA GGGTCTCCTCAT AAGGACTAAAGACCCCTTC NGG
805093 Insertion 11 118472093 118472094 A AC AATTAATGAGGAGACCCGAA GGGTCTCCTCA AAGGACTAAAGACCCCTTC NGG
805093 Insertion 11 118472093 118472094 A AC GAATTAATGAGGAGACCCGA GGTCTCCTCATTA AAGGACTAAAGACCCCTTCG NGG
805093 Insertion 11 118472093 118472094 A AC GAATTAATGAGGAGACCCGA GGTCTCCTCATT AAGGACTAAAGACCCCTTCG NGG
1020806 Insertion 11 118472554 118472555 T TG AGATTCAGTGCCCCGTCCTG GACGGGGC GCTGAGACAGCTGCACTTGATTTTTCAGAAGATCCACAG NGG
1020806 Insertion 11 118472554 118472555 T TG AGATTCAGTGCCCCGTCCTG GACGGGGC TGCTGAGACAGCTGCACTTGATTTTTCAGAAGATCCACAG NGG
1020806 Insertion 11 118472554 118472555 T TG AGATTCAGTGCCCCGTCCTG GACGGGGC GGAGTGCTGAGACAGCTGCACTTGATTTTTCAGAAGATCCACAG NGG
1020806 Insertion 11 118472554 118472555 T TG AGATTCAGTGCCCCGTCCTG GACGGGGC GTGCTGAGACAGCTGCACTTGATTTTTCAGAAGATCCACAG NGG
1020806 Insertion 11 118472554 118472555 T TG AGATTCAGTGCCCCGTCCTG GACGGGGC TGAGACAGCTGCACTTGATTTTTCAGAAGATCCACAG NGG
1020806 Insertion 11 118472554 118472555 T TG AGATTCAGTGCCCCGTCCTG GACGGGGC CTGAGACAGCTGCACTTGATTTTTCAGAAGATCCACAG NGG
1020806 Insertion 11 118472554 118472555 T TG AGATTCAGTGCCCCGTCCTG GACGGGGC AGTGCTGAGACAGCTGCACTTGATTTTTCAGAAGATCCACAG NGG
1020806 Insertion 11 118472554 118472555 T TG AGATTCAGTGCCCCGTCCTG GACGGGGC AGGAGTGCTGAGACAGCTGCACTTGATTTTTCAGAAGATCCACAG NGG
1020806 Insertion 11 118472554 118472555 T TG AGATTCAGTGCCCCGTCCTG GACGGGGC GAGTGCTGAGACAGCTGCACTTGATTTTTCAGAAGATCCACAG NGG
1020806 Insertion 11 118472554 118472555 T TG AGATTCAGTGCCCCGTCCTG GACGGGGCA GCTGAGACAGCTGCACTTGATTTTTCAGAAGATCCACAG NGG
408282 Insertion 11 118491201 118491202 T TTCTGAAACTC TCATAACATTTGTCACAGAG TGTGACAAATGTTA AGGAAACTTCTGAAACTCTCTGCCCTCTC NGG
408282 Insertion 11 118491201 118491202 T TTCTGAAACTC TCATAACATTTGTCACAGAG TGTGACAAATGTTA GGAAACTTCTGAAACTCTCTGCCCTCTC NGG
408282 Insertion 11 118491201 118491202 T TTCTGAAACTC TCATAACATTTGTCACAGAG TGTGACAAATGTTA TCAGGAAACTTCTGAAACTCTCTGCCCTCTC NGG
408282 Insertion 11 118491201 118491202 T TTCTGAAACTC TCATAACATTTGTCACAGAG TGTGACAAATGTTA CAGGAAACTTCTGAAACTCTCTGCCCTCTC NGG
408282 Insertion 11 118491201 118491202 T TTCTGAAACTC TCATAACATTTGTCACAGAG TGTGACAAATGTT AGGAAACTTCTGAAACTCTCTGCCCTCTC NGG
408282 Insertion 11 118491201 118491202 T TTCTGAAACTC TCATAACATTTGTCACAGAG TGTGACAAATGTT GGAAACTTCTGAAACTCTCTGCCCTCTC NGG
408282 Insertion 11 118491201 118491202 T TTCTGAAACTC TCATAACATTTGTCACAGAG TGTGACAAATGT GGAAACTTCTGAAACTCTCTGCCCTCTC NGG
408282 Insertion 11 118491201 118491202 T TTCTGAAACTC TCATAACATTTGTCACAGAG TGTGACAAATGT AGGAAACTTCTGAAACTCTCTGCCCTCTC NGG
408282 Insertion 11 118491201 118491202 T TTCTGAAACTC TCATAACATTTGTCACAGAG TGTGACAAATGTTAT AGGAAACTTCTGAAACTCTCTGCCCTCTC NGG
408282 Insertion 11 118491201 118491202 T TTCTGAAACTC TCATAACATTTGTCACAGAG TGTGACAAATGTT TCAGGAAACTTCTGAAACTCTCTGCCCTCTC NGG
511883 Deletion 11 118436642 118436642 GC G GCCACCGCCGACCGGGGGCC CCCCGGTCGG CTTCCCCCCGGG NGG
511883 Deletion 11 118436642 118436642 GC G GCCACCGCCGACCGGGGGCC CCCCGGTCG CTTCCCCCCGGG NGG
511883 Deletion 11 118436642 118436642 GC G GCCACCGCCGACCGGGGGCC CCCCGGTC CTTCCCCCCGGG NGG
511883 Deletion 11 118436642 118436642 GC G GCCACCGCCGACCGGGGGCC CCCCGGTCGG TTCCCCCCGGG NGG
511883 Deletion 11 118436642 118436642 GC G GCCACCGCCGACCGGGGGCC CCCCGGTCGG CCCCCCGGG NGG
511883 Deletion 11 118436642 118436642 GC G GCCACCGCCGACCGGGGGCC CCCCGGTCGGC CTTCCCCCCGGG NGG
511883 Deletion 11 118436642 118436642 GC G GCCACCGCCGACCGGGGGCC CCCCGGTCG TTCCCCCCGGG NGG
511883 Deletion 11 118436642 118436642 GC G GGGCCGCCACCGCCGACCGG GTCGGCGGTG CCGGGCCCCG NGG
511883 Deletion 11 118436642 118436642 GC G GGGCCGCCACCGCCGACCGG GTCGGCGGTG CCCGGGCCCCG NGG
511883 Deletion 11 118436642 118436642 GC G GCCACCGCCGACCGGGGGCC CCCCGGTCGGCG CTTCCCCCCGGG NGG
1178838 Deletion 11 118436655 118436689 GGTGGCGGCCCCGGGGCGCCCCCCTCCCCCCCGGCT G GCCGCCGCGGCCGCCACAGC GTGGCGGC CCCCGGTCGGCG NGG
1178838 Deletion 11 118436655 118436689 GGTGGCGGCCCCGGGGCGCCCCCCTCCCCCCCGGCT G GCCGCCGCGGCCGCCACAGC GTGGCGGC CCCGGTCGGCG NGG
1178838 Deletion 11 118436655 118436689 GGTGGCGGCCCCGGGGCGCCCCCCTCCCCCCCGGCT G GCCGCCGCGGCCGCCACAGC GTGGCGGC CCCCCGGTCGGCG NGG
1178838 Deletion 11 118436655 118436689 GGTGGCGGCCCCGGGGCGCCCCCCTCCCCCCCGGCT G GCCGCCGCGGCCGCCACAGC GTGGCGGCC CCCGGTCGGCG NGG
1178838 Deletion 11 118436655 118436689 GGTGGCGGCCCCGGGGCGCCCCCCTCCCCCCCGGCT G GCCGCCGCGGCCGCCACAGC GTGGCGGCC CCCCGGTCGGCG NGG
1178838 Deletion 11 118436655 118436689 GGTGGCGGCCCCGGGGCGCCCCCCTCCCCCCCGGCT G GCCGCCGCGGCCGCCACAGC GTGGCGGCCG CCCGGTCGGCG NGG
1178838 Deletion 11 118436655 118436689 GGTGGCGGCCCCGGGGCGCCCCCCTCCCCCCCGGCT G GCCGCCGCGGCCGCCACAGC GTGGCGGC CCGGTCGGCG NGG
1178838 Deletion 11 118436655 118436689 GGTGGCGGCCCCGGGGCGCCCCCCTCCCCCCCGGCT G GCCGCCGCGGCCGCCACAGC GTGGCGGCCG CCCCGGTCGGCG NGG
1178838 Deletion 11 118436655 118436689 GGTGGCGGCCCCGGGGCGCCCCCCTCCCCCCCGGCT G GCCGCCGCGGCCGCCACAGC GTGGCGGCC CCCCCGGTCGGCG NGG
1178838 Deletion 11 118436655 118436689 GGTGGCGGCCCCGGGGCGCCCCCCTCCCCCCCGGCT G GCCGCCGCGGCCGCCACAGC GTGGCGGCC CCGGTCGGCG NGG
973769 Deletion 11 118436679 118436679 TC T GCCGCGGCCGCCACAGCCGG GCTGTGGCGG CCCCTCCCCCCG NGG
973769 Deletion 11 118436679 118436679 TC T GCCGCGGCCGCCACAGCCGG GCTGTGGCG CCCCTCCCCCCG NGG
973769 Deletion 11 118436679 118436679 TC T GCCGCGGCCGCCACAGCCGG GCTGTGGC CCCCTCCCCCCG NGG
973769 Deletion 11 118436679 118436679 TC T GCCGCGGCCGCCACAGCCGG GCTGTGGCGG CCCCCTCCCCCCG NGG
973769 Deletion 11 118436679 118436679 TC T CGCGGCCGCCACAGCCGGGG CGGCTGTGGC CCCCTCCCCC NGG
973769 Deletion 11 118436679 118436679 TC T GCCGCGGCCGCCACAGCCGG GCTGTGGCGGC CCCCTCCCCCCG NGG
973769 Deletion 11 118436679 118436679 TC T CGCGGCCGCCACAGCCGGGG CGGCTGTGGC CCCCCTCCCCC NGG
973769 Deletion 11 118436679 118436679 TC T GCCGCGGCCGCCACAGCCGG GCTGTGGCG CCCCCTCCCCCCG NGG
973769 Deletion 11 118436679 118436679 TC T CGCGGCCGCCACAGCCGGGG CGGCTGTGGCG CCCCTCCCCC NGG
973769 Deletion 11 118436679 118436679 TC T GGCCGCCACAGCCGGGGGGG CCCCGGCTG CCCCCCTCC NGG
973770 Deletion 11 118436819 118436819 GC G GGGCCCACCCGGAGCAGGGC CTGCTCCGG TTCAGGGCGGCC NGG
973770 Deletion 11 118436819 118436819 GC G GGGCCCACCCGGAGCAGGGC CTGCTCCGGG TTCAGGGCGGCC NGG
973770 Deletion 11 118436819 118436819 GC G GGGCCCACCCGGAGCAGGGC CTGCTCCG TTCAGGGCGGCC NGG
973770 Deletion 11 118436819 118436819 GC G gtcctcagcctcttcAGGGC CTGAAGAGG CAGGGCCGCC NGG
973770 Deletion 11 118436819 118436819 GC G GGGCCCACCCGGAGCAGGGC CTGCTCCGG CTTCAGGGCGGCC NGG
973770 Deletion 11 118436819 118436819 GC G GGGCCCACCCGGAGCAGGGC CTGCTCCGGGT TTCAGGGCGGCC NGG
973770 Deletion 11 118436819 118436819 GC G GGGCCCACCCGGAGCAGGGC CTGCTCCGGG TCAGGGCGGCC NGG
973770 Deletion 11 118436819 118436819 GC G GGGCCCACCCGGAGCAGGGC CTGCTCCGGG CAGGGCGGCC NGG
973770 Deletion 11 118436819 118436819 GC G GGGCCCACCCGGAGCAGGGC CTGCTCCGG TCAGGGCGGCC NGG
973770 Deletion 11 118436819 118436819 GC G gtcctcagcctcttcAGGGC CTGAAGAGGC CAGGGCCGCC NGG
973772 Deletion 11 118471919 118471919 GA G GCTTGCTGAAACGTAGCAGA GCTACGTTTCAGC GCCTGAAAAAATTAAAAGGACACCTTCT NGG
973772 Deletion 11 118471919 118471919 GA G GCTTGCTGAAACGTAGCAGA GCTACGTTTCAGC AGCCTGAAAAAATTAAAAGGACACCTTCT NGG
973772 Deletion 11 118471919 118471919 GA G GCTTGCTGAAACGTAGCAGA GCTACGTTTCAGCA GCCTGAAAAAATTAAAAGGACACCTTCT NGG
973772 Deletion 11 118471919 118471919 GA G GCTTGCTGAAACGTAGCAGA GCTACGTTTCAGCA AGCCTGAAAAAATTAAAAGGACACCTTCT NGG
973772 Deletion 11 118471919 118471919 GA G GCTTGCTGAAACGTAGCAGA GCTACGTTTCAGC TAGCCTGAAAAAATTAAAAGGACACCTTCT NGG
973772 Deletion 11 118471919 118471919 GA G GCTTGCTGAAACGTAGCAGA GCTACGTTTCAGCAA GCCTGAAAAAATTAAAAGGACACCTTCT NGG
973772 Deletion 11 118471919 118471919 GA G GCTTGCTGAAACGTAGCAGA GCTACGTTTCAGC GATAGCCTGAAAAAATTAAAAGGACACCTTCT NGG
973772 Deletion 11 118471919 118471919 GA G GCTTGCTGAAACGTAGCAGA GCTACGTTTCAGC ATAGCCTGAAAAAATTAAAAGGACACCTTCT NGG
973772 Deletion 11 118471919 118471919 GA G GCTTGCTGAAACGTAGCAGA GCTACGTTTCAGCAA AGCCTGAAAAAATTAAAAGGACACCTTCT NGG
973772 Deletion 11 118471919 118471919 GA G GCTTGCTGAAACGTAGCAGA GCTACGTTTCAGCA TAGCCTGAAAAAATTAAAAGGACACCTTCT NGG
859835 Deletion 11 118472044 118472044 AG A GCTTCAAATAGGAAGGAAGG TCCTTCCT TTTGTACCCCT NGG
859835 Deletion 11 118472044 118472044 AG A GCTTCAAATAGGAAGGAAGG TCCTTCCTAT TTTGTACCCCT NGG
859835 Deletion 11 118472044 118472044 AG A GCTTCAAATAGGAAGGAAGG TCCTTCCTA TTTGTACCCCT NGG
859835 Deletion 11 118472044 118472044 AG A GCTTCAAATAGGAAGGAAGG TCCTTCCTAT TTGTACCCCT NGG
859835 Deletion 11 118472044 118472044 AG A GCTTCAAATAGGAAGGAAGG TCCTTCCTATT TTTGTACCCCT NGG
859835 Deletion 11 118472044 118472044 AG A GCTTCAAATAGGAAGGAAGG TCCTTCCT TTGTACCCCT NGG
859835 Deletion 11 118472044 118472044 AG A GCTTCAAATAGGAAGGAAGG TCCTTCCT ATTTGTACCCCT NGG
859835 Deletion 11 118472044 118472044 AG A GCTTCAAATAGGAAGGAAGG TCCTTCCTATT TTGTACCCCT NGG
859835 Deletion 11 118472044 118472044 AG A GCTTCAAATAGGAAGGAAGG TCCTTCCTA TTGTACCCCT NGG
859835 Deletion 11 118472044 118472044 AG A GCTTCAAATAGGAAGGAAGG TCCTTCCT CAATTTGTACCCCT NGG
513720 Deletion 11 118472197 118472197 CA C TAACTGGCTTAATCCTTCGA AAGGATTAAGCCAGT AAGACGTTGTCAGACAAAGCCCTCG NGG
513720 Deletion 11 118472197 118472197 CA C TAACTGGCTTAATCCTTCGA AAGGATTAAGCCAGT GATAAGACGTTGTCAGACAAAGCCCTCG NGG
513720 Deletion 11 118472197 118472197 CA C TAACTGGCTTAATCCTTCGA AAGGATTAAGCCAG AAGACGTTGTCAGACAAAGCCCTCG NGG
513720 Deletion 11 118472197 118472197 CA C TAACTGGCTTAATCCTTCGA AAGGATTAAGCCAGTTAG AAGACGTTGTCAGACAAAGCCCTCG NGG
513720 Deletion 11 118472197 118472197 CA C TAACTGGCTTAATCCTTCGA AAGGATTAAGCCAGT TAAGACGTTGTCAGACAAAGCCCTCG NGG
513720 Deletion 11 118472197 118472197 CA C TAACTGGCTTAATCCTTCGA AAGGATTAAGCCAGTTAG GATAAGACGTTGTCAGACAAAGCCCTCG NGG
513720 Deletion 11 118472197 118472197 CA C TAACTGGCTTAATCCTTCGA AAGGATTAAGCCAGT AGATAAGACGTTGTCAGACAAAGCCCTCG NGG
513720 Deletion 11 118472197 118472197 CA C TAACTGGCTTAATCCTTCGA AAGGATTAAGCCAGTTAG AGATAAGACGTTGTCAGACAAAGCCCTCG NGG
513720 Deletion 11 118472197 118472197 CA C TAACTGGCTTAATCCTTCGA AAGGATTAAGCCAGTT AAGACGTTGTCAGACAAAGCCCTCG NGG
513720 Deletion 11 118472197 118472197 CA C TAACTGGCTTAATCCTTCGA AAGGATTAAGCCAGTTAG GAAGATAAGACGTTGTCAGACAAAGCCCTCG NGG
798636 Deletion 11 118473002 118473002 AC A AAAGAAGTCCACCTAAATGT TTTAGGTGGACTT GAGAACGACA NGG
798636 Deletion 11 118473002 118473002 AC A AAAGAAGTCCACCTAAATGT TTTAGGTGGACTTCT GAGAACGACA NGG
798636 Deletion 11 118473002 118473002 AC A AAAGAAGTCCACCTAAATGT TTTAGGTGGACTTCT CGAGAACGACA NGG
798636 Deletion 11 118473002 118473002 AC A AAAGAAGTCCACCTAAATGT TTTAGGTGGACTTC GAGAACGACA NGG
798636 Deletion 11 118473002 118473002 AC A AAAGAAGTCCACCTAAATGT TTTAGGTGGACTT CGAGAACGACA NGG
798636 Deletion 11 118473002 118473002 AC A AAAGAAGTCCACCTAAATGT TTTAGGTGGACTTC CGAGAACGACA NGG
798636 Deletion 11 118473002 118473002 AC A AAAGAAGTCCACCTAAATGT TTTAGGTGGA CGAGAACGACA NGG
798636 Deletion 11 118473002 118473002 AC A AAAGAAGTCCACCTAAATGT TTTAGGTGGACTTCT GCGAGAACGACA NGG
798636 Deletion 11 118473002 118473002 AC A AAAGAAGTCCACCTAAATGT TTTAGGTGGACTTC GCGAGAACGACA NGG
798636 Deletion 11 118473002 118473002 AC A AAAGAAGTCCACCTAAATGT TTTAGGTGGACT GAGAACGACA NGG
205267 Deletion 11 118473025 118473025 TA T TTTTGCGAGAACCGACATTT TGTCGGTTCTCGC TGCTTAAAGAAGTCCACCTAAA NGG
205267 Deletion 11 118473025 118473025 TA T TTTTGCGAGAACCGACATTT TGTCGGTTCTCGCA TGCTTAAAGAAGTCCACCTAAA NGG
205267 Deletion 11 118473025 118473025 TA T TTTTGCGAGAACCGACATTT TGTCGGTTCTCGC ATGCTTAAAGAAGTCCACCTAAA NGG
205267 Deletion 11 118473025 118473025 TA T TTTTGCGAGAACCGACATTT TGTCGGTTCTCGCA ATGCTTAAAGAAGTCCACCTAAA NGG
205267 Deletion 11 118473025 118473025 TA T TTTTGCGAGAACCGACATTT TGTCGGTTCTCGCAA TGCTTAAAGAAGTCCACCTAAA NGG
205267 Deletion 11 118473025 118473025 TA T TTTTGCGAGAACCGACATTT TGTCGGTTCTCGC GGCTCTGACCTAGAATGCTTAAAGAAGTCCACCTAAA NGG
205267 Deletion 11 118473025 118473025 TA T TTTTGCGAGAACCGACATTT TGTCGGTTCTCGC GAATGCTTAAAGAAGTCCACCTAAA NGG
205267 Deletion 11 118473025 118473025 TA T TTTTGCGAGAACCGACATTT TGTCGGTTCTCGC GACCTAGAATGCTTAAAGAAGTCCACCTAAA NGG
205267 Deletion 11 118473025 118473025 TA T TTTTGCGAGAACCGACATTT TGTCGGTTCTCGC AGAATGCTTAAAGAAGTCCACCTAAA NGG
205267 Deletion 11 118473025 118473025 TA T TTTTGCGAGAACCGACATTT TGTCGGTTCTCGC GCTCTGACCTAGAATGCTTAAAGAAGTCCACCTAAA NGG
511885 Deletion 11 118473352 118473352 TA T TCTGCTGGAACATCTTCTTC GAAGATGTTCC TTGGAACTCCTGAA NGG
511885 Deletion 11 118473352 118473352 TA T TCTGCTGGAACATCTTCTTC GAAGATGTTCCAGC TTGGAACTCCTGAA NGG
511885 Deletion 11 118473352 118473352 TA T TCTGCTGGAACATCTTCTTC GAAGATGTTCCAGCA TTGGAACTCCTGAA NGG
511885 Deletion 11 118473352 118473352 TA T TCTGCTGGAACATCTTCTTC GAAGATGTTCCAGC CTATTGGAACTCCTGAA NGG
511885 Deletion 11 118473352 118473352 TA T TCTGCTGGAACATCTTCTTC GAAGATGTTCCAGC ATTGGAACTCCTGAA NGG
511885 Deletion 11 118473352 118473352 TA T TCTGCTGGAACATCTTCTTC GAAGATGTTCCAGCA ATTGGAACTCCTGAA NGG
511885 Deletion 11 118473352 118473352 TA T TCTGCTGGAACATCTTCTTC GAAGATGTTCCAGCA CTATTGGAACTCCTGAA NGG
511885 Deletion 11 118473352 118473352 TA T TCTGCTGGAACATCTTCTTC GAAGATGTTCCA TTGGAACTCCTGAA NGG
511885 Deletion 11 118473352 118473352 TA T TCTGCTGGAACATCTTCTTC GAAGATGTTCCAGC TATTGGAACTCCTGAA NGG
511885 Deletion 11 118473352 118473352 TA T TCTGCTGGAACATCTTCTTC GAAGATGTTCCAGCAG TTGGAACTCCTGAA NGG
511886 Deletion 11 118473420 118473420 TC T CCTTCCACTTCTTGTCCTCA GGACAAGAAGTG CTCACTCATGA NGG
511886 Deletion 11 118473420 118473420 TC T CCTTCCACTTCTTGTCCTCA GGACAAGAAG CTCACTCATGA NGG
511886 Deletion 11 118473420 118473420 TC T CCTTCCACTTCTTGTCCTCA GGACAAGAAGTGG CTCACTCATGA NGG
511886 Deletion 11 118473420 118473420 TC T CCTTCCACTTCTTGTCCTCA GGACAAGAAGT CTCACTCATGA NGG
511886 Deletion 11 118473420 118473420 TC T CCTTCCACTTCTTGTCCTCA GGACAAGAAGTGGA CTCACTCATGA NGG
511886 Deletion 11 118473420 118473420 TC T CCTTCCACTTCTTGTCCTCA GGACAAGAA CTCACTCATGA NGG
511886 Deletion 11 118473420 118473420 TC T CCTTCCACTTCTTGTCCTCA GGACAAGAAGTGGAA CTCACTCATGA NGG
511886 Deletion 11 118473420 118473420 TC T CCTTCCACTTCTTGTCCTCA GGACAAGAAGTGGAAGG CTCACTCATGA NGG
511886 Deletion 11 118473420 118473420 TC T CCTTCCACTTCTTGTCCTCA GGACAAGAAGTGGAAG CTCACTCATGA NGG
511886 Deletion 11 118473420 118473420 TC T CCTTCCACTTCTTGTCCTCA GGACAAGA CTCACTCATGA NGG
511887 Deletion 11 118473471 118473471 AC A GGAAGAGACAGAAGACGGGG CGTCTTCTGTC CTCTCACCCCC NGG
511887 Deletion 11 118473471 118473471 AC A GGAAGAGACAGAAGACGGGG CGTCTTCTGTCT CTCTCACCCCC NGG
511887 Deletion 11 118473471 118473471 AC A GGAAGAGACAGAAGACGGGG CGTCTTCTGTC CCTCTCACCCCC NGG
511887 Deletion 11 118473471 118473471 AC A GGAAGAGACAGAAGACGGGG CGTCTTCTGTCTC CTCTCACCCCC NGG
511887 Deletion 11 118473471 118473471 AC A GGAAGAGACAGAAGACGGGG CGTCTTCTGTCT CCTCTCACCCCC NGG
511887 Deletion 11 118473471 118473471 AC A GGAAGAGACAGAAGACGGGG CGTCTTCTGTCTCT CTCTCACCCCC NGG
511887 Deletion 11 118473471 118473471 AC A GGAAGAGACAGAAGACGGGG CGTCTTCTGTCTC CCTCTCACCCCC NGG
511887 Deletion 11 118473471 118473471 AC A GGAAGAGACAGAAGACGGGG CGTCTTCTGTCTCT CCTCTCACCCCC NGG
511887 Deletion 11 118473471 118473471 AC A GGAAGAGACAGAAGACGGGG CGTCTTCTGTC ACCTCTCACCCCC NGG
511887 Deletion 11 118473471 118473471 AC A GGAAGAGACAGAAGACGGGG CGTCTTCTGT CTCTCACCCCC NGG
408278 Deletion 11 118473506 118473507 TTC T TTTAAGGCACTAGTGGCAAG GCCACTAGTGCCT AGCATTTGTTAGTCCTCTT NGG
408278 Deletion 11 118473506 118473507 TTC T TTTAAGGCACTAGTGGCAAG GCCACTAGTGCC GCATTTGTTAGTCCTCTT NGG
408278 Deletion 11 118473506 118473507 TTC T TTTAAGGCACTAGTGGCAAG GCCACTAGTGCCT GCATTTGTTAGTCCTCTT NGG
408278 Deletion 11 118473506 118473507 TTC T TTTAAGGCACTAGTGGCAAG GCCACTAGTGCC AGCATTTGTTAGTCCTCTT NGG
408278 Deletion 11 118473506 118473507 TTC T TTTAAGGCACTAGTGGCAAG GCCACTAGTGC AGCATTTGTTAGTCCTCTT NGG
408278 Deletion 11 118473506 118473507 TTC T TTTAAGGCACTAGTGGCAAG GCCACTAGTGC GCATTTGTTAGTCCTCTT NGG
408278 Deletion 11 118473506 118473507 TTC T TTTAAGGCACTAGTGGCAAG GCCACTAGTGCCTT GCATTTGTTAGTCCTCTT NGG
408278 Deletion 11 118473506 118473507 TTC T TTTAAGGCACTAGTGGCAAG GCCACTAGTGCCTT AGCATTTGTTAGTCCTCTT NGG
408278 Deletion 11 118473506 118473507 TTC T TTTAAGGCACTAGTGGCAAG GCCACTAGTGCCT AAGCATTTGTTAGTCCTCTT NGG
408278 Deletion 11 118473506 118473507 TTC T TTTAAGGCACTAGTGGCAAG GCCACTAGTGCC AAGCATTTGTTAGTCCTCTT NGG
444728 Deletion 11 118473672 118473672 TG T GTCCTACTCCTCTCTTCCCT GAAGAGAGGA GGTAAACAAGG NGG
444728 Deletion 11 118473672 118473672 TG T GTCCTACTCCTCTCTTCCCT GAAGAGAGGA GTAAACAAGG NGG
444728 Deletion 11 118473672 118473672 TG T GTCCTACTCCTCTCTTCCCT GAAGAGAGGA GGGTAAACAAGG NGG
444728 Deletion 11 118473672 118473672 TG T GTCCTACTCCTCTCTTCCCT GAAGAGAGG GGTAAACAAGG NGG
444728 Deletion 11 118473672 118473672 TG T GTCCTACTCCTCTCTTCCCT GAAGAGAGG GGGTAAACAAGG NGG
444728 Deletion 11 118473672 118473672 TG T GTCCTACTCCTCTCTTCCCT GAAGAGAGGA CTGGGGTAAACAAGG NGG
444728 Deletion 11 118473672 118473672 TG T GTCCTACTCCTCTCTTCCCT GAAGAGAGGA GGGGTAAACAAGG NGG
444728 Deletion 11 118473672 118473672 TG T GTCCTACTCCTCTCTTCCCT GAAGAGAGGA TGGGGTAAACAAGG NGG
444728 Deletion 11 118473672 118473672 TG T GTCCTACTCCTCTCTTCCCT GAAGAGAGG GTAAACAAGG NGG
444728 Deletion 11 118473672 118473672 TG T GTCCTACTCCTCTCTTCCCT GAAGAGAGG CTGGGGTAAACAAGG NGG
838041 Deletion 11 118473678 118473678 AC A TCTTTCAGTCTGAGAGCCTG GCTCTCAGAC GTTTACCCAG NGG
838041 Deletion 11 118473678 118473678 AC A TCTTTCAGTCTGAGAGCCTG GCTCTCAGAC GGTTTACCCAG NGG
838041 Deletion 11 118473678 118473678 AC A TCTTTCAGTCTGAGAGCCTG GCTCTCAGAC TGGTTTACCCAG NGG
838041 Deletion 11 118473678 118473678 AC A TCTTTCAGTCTGAGAGCCTG GCTCTCAGACT GTTTACCCAG NGG
838041 Deletion 11 118473678 118473678 AC A TCTTTCAGTCTGAGAGCCTG GCTCTCAGAC TTGGTTTACCCAG NGG
838041 Deletion 11 118473678 118473678 AC A TCTTTCAGTCTGAGAGCCTG GCTCTCAGACT GGTTTACCCAG NGG
838041 Deletion 11 118473678 118473678 AC A TCTTTCAGTCTGAGAGCCTG GCTCTCAGACTG GTTTACCCAG NGG
838041 Deletion 11 118473678 118473678 AC A TCTTTCAGTCTGAGAGCCTG GCTCTCAGACT TGGTTTACCCAG NGG
838041 Deletion 11 118473678 118473678 AC A GTCCTACTCCTCTCTTCCCT GAAGAGAGGA CTGGGTAAACCAAGG NGG
838041 Deletion 11 118473678 118473678 AC A TCTTTCAGTCTGAGAGCCTG GCTCTCAGACTG TGGTTTACCCAG NGG
801870 Deletion 11 118473710 118473711 TAA T ATCTTTGGACAGCTCCTCGG AGGAGCTGTCC GAAATAGACAAGGCCCCCG NGG
801870 Deletion 11 118473710 118473711 TAA T GATCTTTGGACAGCTCCTCG GGAGCTGTCC GAAATAGACAAGGCCCCCGA NGG
801870 Deletion 11 118473710 118473711 TAA T ATCTTTGGACAGCTCCTCGG AGGAGCTGTCC AGAAATAGACAAGGCCCCCG NGG
801870 Deletion 11 118473710 118473711 TAA T ATCTTTGGACAGCTCCTCGG AGGAGCTGTCCA GAAATAGACAAGGCCCCCG NGG
801870 Deletion 11 118473710 118473711 TAA T ATCTTTGGACAGCTCCTCGG AGGAGCTGTCCAA GAAATAGACAAGGCCCCCG NGG
801870 Deletion 11 118473710 118473711 TAA T ATCTTTGGACAGCTCCTCGG AGGAGCTGTCCAAA GAAATAGACAAGGCCCCCG NGG
801870 Deletion 11 118473710 118473711 TAA T GATCTTTGGACAGCTCCTCG GGAGCTGTCCA GAAATAGACAAGGCCCCCGA NGG
801870 Deletion 11 118473710 118473711 TAA T GATCTTTGGACAGCTCCTCG GGAGCTGTCC AGAAATAGACAAGGCCCCCGA NGG
801870 Deletion 11 118473710 118473711 TAA T ATCTTTGGACAGCTCCTCGG AGGAGCTGTCC GAGAAATAGACAAGGCCCCCG NGG
801870 Deletion 11 118473710 118473711 TAA T GATCTTTGGACAGCTCCTCG GGAGCTGTCCAA GAAATAGACAAGGCCCCCGA NGG
805663 Deletion 11 118473778 118473779 GTA G TCGAGATGCTGACAagagcg TCTTGTCAGCATC GGTCTCTCTCTCCTCTTGTCCTTCTCCACGC NGG
805663 Deletion 11 118473778 118473779 GTA G TCGAGATGCTGACAagagcg TCTTGTCAGCATCTC GGTCTCTCTCTCCTCTTGTCCTTCTCCACGC NGG
805663 Deletion 11 118473778 118473779 GTA G TCGAGATGCTGACAagagcg TCTTGTCAGCATC CGGTCTCTCTCTCCTCTTGTCCTTCTCCACGC NGG
805663 Deletion 11 118473778 118473779 GTA G TCGAGATGCTGACAagagcg TCTTGTCAGCATC CCGGTCTCTCTCTCCTCTTGTCCTTCTCCACGC NGG
805663 Deletion 11 118473778 118473779 GTA G TCGAGATGCTGACAagagcg TCTTGTCAGCATC CCCGGTCTCTCTCTCCTCTTGTCCTTCTCCACGC NGG
805663 Deletion 11 118473778 118473779 GTA G TCGAGATGCTGACAagagcg TCTTGTCAGCATCT GGTCTCTCTCTCCTCTTGTCCTTCTCCACGC NGG
805663 Deletion 11 118473778 118473779 GTA G TCGAGATGCTGACAagagcg TCTTGTCAGCATCTC CGGTCTCTCTCTCCTCTTGTCCTTCTCCACGC NGG
805663 Deletion 11 118473778 118473779 GTA G TCGAGATGCTGACAagagcg TCTTGTCAGCATC TCCCGGTCTCTCTCTCCTCTTGTCCTTCTCCACGC NGG
805663 Deletion 11 118473778 118473779 GTA G TCGAGATGCTGACAagagcg TCTTGTCAGCATC CTCCCGGTCTCTCTCTCCTCTTGTCCTTCTCCACGC NGG
805663 Deletion 11 118473778 118473779 GTA G TCGAGATGCTGACAagagcg TCTTGTCAGCATCT CGGTCTCTCTCTCCTCTTGTCCTTCTCCACGC NGG
1062245 Deletion 11 118474024 118474024 CT C TATTACTTCTGTGACTCTTG GAGTCACAGA TTGACGCTGTTGTATCCCCAA NGG
1062245 Deletion 11 118474024 118474024 CT C TATTACTTCTGTGACTCTTG GAGTCACAGAA TTGACGCTGTTGTATCCCCAA NGG
1062245 Deletion 11 118474024 118474024 CT C ATATTACTTCTGTGACTCTT AGTCACAGAAG TTGACGCTGTTGTATCCCCAAG NGG
1062245 Deletion 11 118474024 118474024 CT C TATTACTTCTGTGACTCTTG GAGTCACAGAAG TTGACGCTGTTGTATCCCCAA NGG
1062245 Deletion 11 118474024 118474024 CT C ATATTACTTCTGTGACTCTT AGTCACAGAAGT TTGACGCTGTTGTATCCCCAAG NGG
1062245 Deletion 11 118474024 118474024 CT C TATTACTTCTGTGACTCTTG GAGTCACAGAAGT TTGACGCTGTTGTATCCCCAA NGG
1062245 Deletion 11 118474024 118474024 CT C ATATTACTTCTGTGACTCTT AGTCACAGAAGTA TTGACGCTGTTGTATCCCCAAG NGG
1062245 Deletion 11 118474024 118474024 CT C ATATTACTTCTGTGACTCTT AGTCACAGAA TTGACGCTGTTGTATCCCCAAG NGG
1062245 Deletion 11 118474024 118474024 CT C TATTACTTCTGTGACTCTTG GAGTCACAG TTGACGCTGTTGTATCCCCAA NGG
1062245 Deletion 11 118474024 118474024 CT C ATATTACTTCTGTGACTCTT AGTCACAGA TTGACGCTGTTGTATCCCCAAG NGG
1062246 Deletion 11 118474220 118474242 CAAGAGGGTTGCCAGCCTCCTAAA C AATCTTGCAGAGCTGAGCTT CTCAGCTC CTGACAAAGGCCAAAG NGG
1062246 Deletion 11 118474220 118474242 CAAGAGGGTTGCCAGCCTCCTAAA C AATCTTGCAGAGCTGAGCTT CTCAGCTCT CTGACAAAGGCCAAAG NGG
1062246 Deletion 11 118474220 118474242 CAAGAGGGTTGCCAGCCTCCTAAA C AATCTTGCAGAGCTGAGCTT CTCAGCTC ACTGACAAAGGCCAAAG NGG
1062246 Deletion 11 118474220 118474242 CAAGAGGGTTGCCAGCCTCCTAAA C AATCTTGCAGAGCTGAGCTT CTCAGCTC GACTGACAAAGGCCAAAG NGG
1062246 Deletion 11 118474220 118474242 CAAGAGGGTTGCCAGCCTCCTAAA C AATCTTGCAGAGCTGAGCTT CTCAGCTCT ACTGACAAAGGCCAAAG NGG
1062246 Deletion 11 118474220 118474242 CAAGAGGGTTGCCAGCCTCCTAAA C AATCTTGCAGAGCTGAGCTT CTCAGCTCT GACTGACAAAGGCCAAAG NGG
1062246 Deletion 11 118474220 118474242 CAAGAGGGTTGCCAGCCTCCTAAA C AATCTTGCAGAGCTGAGCTT CTCAGCTCTG CTGACAAAGGCCAAAG NGG
1062246 Deletion 11 118474220 118474242 CAAGAGGGTTGCCAGCCTCCTAAA C AATCTTGCAGAGCTGAGCTT CTCAGCTCTGC CTGACAAAGGCCAAAG NGG
1062246 Deletion 11 118474220 118474242 CAAGAGGGTTGCCAGCCTCCTAAA C AATCTTGCAGAGCTGAGCTT CTCAGCTC TGACTGACAAAGGCCAAAG NGG
1062246 Deletion 11 118474220 118474242 CAAGAGGGTTGCCAGCCTCCTAAA C AATCTTGCAGAGCTGAGCTT CTCAGCTCTGCAA CTGACAAAGGCCAAAG NGG
798637 Deletion 11 118476795 118476806 CTCATATTCAGGG C AATCCGGGGTCCTCGCACAG TGCGAGGAC TGGATTGCCTCAAGAAAGTGACTCATCAGAGACCTCTG NGG
798637 Deletion 11 118476795 118476806 CTCATATTCAGGG C AATCCGGGGTCCTCGCACAG TGCGAGGAC GGATTGCCTCAAGAAAGTGACTCATCAGAGACCTCTG NGG
798637 Deletion 11 118476795 118476806 CTCATATTCAGGG C AATCCGGGGTCCTCGCACAG TGCGAGGACC TGGATTGCCTCAAGAAAGTGACTCATCAGAGACCTCTG NGG
798637 Deletion 11 118476795 118476806 CTCATATTCAGGG C AATCCGGGGTCCTCGCACAG TGCGAGGAC TTGGATTGCCTCAAGAAAGTGACTCATCAGAGACCTCTG NGG
798637 Deletion 11 118476795 118476806 CTCATATTCAGGG C AATCCGGGGTCCTCGCACAG TGCGAGGAC TTGCCTCAAGAAAGTGACTCATCAGAGACCTCTG NGG
798637 Deletion 11 118476795 118476806 CTCATATTCAGGG C AATCCGGGGTCCTCGCACAG TGCGAGGACC GGATTGCCTCAAGAAAGTGACTCATCAGAGACCTCTG NGG
798637 Deletion 11 118476795 118476806 CTCATATTCAGGG C AATCCGGGGTCCTCGCACAG TGCGAGGAC ATTGCCTCAAGAAAGTGACTCATCAGAGACCTCTG NGG
798637 Deletion 11 118476795 118476806 CTCATATTCAGGG C AATCCGGGGTCCTCGCACAG TGCGAGGACC TTGCCTCAAGAAAGTGACTCATCAGAGACCTCTG NGG
798637 Deletion 11 118476795 118476806 CTCATATTCAGGG C AATCCGGGGTCCTCGCACAG TGCGAGGAC GATTGCCTCAAGAAAGTGACTCATCAGAGACCTCTG NGG
798637 Deletion 11 118476795 118476806 CTCATATTCAGGG C AATCCGGGGTCCTCGCACAG TGCGAGGACC TTGGATTGCCTCAAGAAAGTGACTCATCAGAGACCTCTG NGG
975302 Deletion 11 118477972 118477972 GT G GGTTTGATGGGTGGAGCAAG GCTCCACCC ACAAGCATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
975302 Deletion 11 118477972 118477972 GT G GGTTTGATGGGTGGAGCAAG GCTCCACCC GACAAGCATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
975302 Deletion 11 118477972 118477972 GT G GGTTTGATGGGTGGAGCAAG GCTCCACCCA ACAAGCATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
975302 Deletion 11 118477972 118477972 GT G GGTTTGATGGGTGGAGCAAG GCTCCACCC AGACAAGCATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
975302 Deletion 11 118477972 118477972 GT G GGTTTGATGGGTGGAGCAAG GCTCCACCCA GACAAGCATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
975302 Deletion 11 118477972 118477972 GT G GGTTTGATGGGTGGAGCAAG GCTCCACCC CAGACAAGCATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
975302 Deletion 11 118477972 118477972 GT G GGTTTGATGGGTGGAGCAAG GCTCCACCCA AGACAAGCATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
975302 Deletion 11 118477972 118477972 GT G GGTTTGATGGGTGGAGCAAG GCTCCACCCAT ACAAGCATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
975302 Deletion 11 118477972 118477972 GT G GGTTTGATGGGTGGAGCAAG GCTCCACCCAT GACAAGCATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
975302 Deletion 11 118477972 118477972 GT G GGTTTGATGGGTGGAGCAAG GCTCCACCC ACAGACAAGCATCAATTGCTGGCTCAGAAGATGCTGAACCTCTT NGG
1062247 Deletion 11 118482005 118482005 GC G CTTGGCGGTCCTGTAGTAGG ACTACAGGA CTCAGCACCT NGG
1062247 Deletion 11 118482005 118482005 GC G CTTGGCGGTCCTGTAGTAGG ACTACAGGA CCTCAGCACCT NGG
1062247 Deletion 11 118482005 118482005 GC G CTTGGCGGTCCTGTAGTAGG ACTACAGGAC CTCAGCACCT NGG
1062247 Deletion 11 118482005 118482005 GC G CTTGGCGGTCCTGTAGTAGG ACTACAGGACCG CTCAGCACCT NGG
1062247 Deletion 11 118482005 118482005 GC G CTTGGCGGTCCTGTAGTAGG ACTACAGGAC CCTCAGCACCT NGG
1062247 Deletion 11 118482005 118482005 GC G CTTGGCGGTCCTGTAGTAGG ACTACAGG CTCAGCACCT NGG
1062247 Deletion 11 118482005 118482005 GC G CTTGGCGGTCCTGTAGTAGG ACTACAGGACCG CCTCAGCACCT NGG
1062247 Deletion 11 118482005 118482005 GC G CTTGGCGGTCCTGTAGTAGG ACTACAGGACC CTCAGCACCT NGG
1062247 Deletion 11 118482005 118482005 GC G CTTGGCGGTCCTGTAGTAGG ACTACAGG CCTCAGCACCT NGG
1062247 Deletion 11 118482005 118482005 GC G CTTGGCGGTCCTGTAGTAGG ACTACAGGACC CCTCAGCACCT NGG
511892 Deletion 11 118482436 118482436 CA C TTTACAGGGATACTTGGGCG CCAAGTATCC GAGCAGAGCAACAGAAAAAAGTGGCTCCCCGC NGG
511892 Deletion 11 118482436 118482436 CA C TTTACAGGGATACTTGGGCG CCAAGTATCC GCAGAGCAACAGAAAAAAGTGGCTCCCCGC NGG
511892 Deletion 11 118482436 118482436 CA C TTTACAGGGATACTTGGGCG CCAAGTATCC AGCAGAGCAACAGAAAAAAGTGGCTCCCCGC NGG
511892 Deletion 11 118482436 118482436 CA C TTTACAGGGATACTTGGGCG CCAAGTATCCC GCAGAGCAACAGAAAAAAGTGGCTCCCCGC NGG
511892 Deletion 11 118482436 118482436 CA C TTTACAGGGATACTTGGGCG CCAAGTATCCC GAGCAGAGCAACAGAAAAAAGTGGCTCCCCGC NGG
511892 Deletion 11 118482436 118482436 CA C TTTACAGGGATACTTGGGCG CCAAGTATCC CAGAGCAGAGCAACAGAAAAAAGTGGCTCCCCGC NGG
511892 Deletion 11 118482436 118482436 CA C TTTACAGGGATACTTGGGCG CCAAGTATCC AGAGCAGAGCAACAGAAAAAAGTGGCTCCCCGC NGG
511892 Deletion 11 118482436 118482436 CA C TTTACAGGGATACTTGGGCG CCAAGTATCCC AGCAGAGCAACAGAAAAAAGTGGCTCCCCGC NGG
511892 Deletion 11 118482436 118482436 CA C TTTACAGGGATACTTGGGCG CCAAGTATCCC CAGAGCAGAGCAACAGAAAAAAGTGGCTCCCCGC NGG
511892 Deletion 11 118482436 118482436 CA C TTTACAGGGATACTTGGGCG CCAAGTATCCC AGAGCAGAGCAACAGAAAAAAGTGGCTCCCCGC NGG
678941 Deletion 11 118482441 118482441 AG A TTTACAGGGATACTTGGGCG CCAAGTATCC GAGCAGAGCAAACAAAAAAAGTGGCTCCCCGC NGG
678941 Deletion 11 118482441 118482441 AG A TTTACAGGGATACTTGGGCG CCAAGTATCCC GAGCAGAGCAAACAAAAAAAGTGGCTCCCCGC NGG
678941 Deletion 11 118482441 118482441 AG A TTTACAGGGATACTTGGGCG CCAAGTATCC GCAGAGCAAACAAAAAAAGTGGCTCCCCGC NGG
678941 Deletion 11 118482441 118482441 AG A TTTACAGGGATACTTGGGCG CCAAGTATCCC GCAGAGCAAACAAAAAAAGTGGCTCCCCGC NGG
678941 Deletion 11 118482441 118482441 AG A TTTACAGGGATACTTGGGCG CCAAGTATCCC GAGCAAACAAAAAAAGTGGCTCCCCGC NGG
678941 Deletion 11 118482441 118482441 AG A TTTACAGGGATACTTGGGCG CCAAGTATCC AGCAGAGCAAACAAAAAAAGTGGCTCCCCGC NGG
678941 Deletion 11 118482441 118482441 AG A TTTACAGGGATACTTGGGCG CCAAGTATCCC AGCAGAGCAAACAAAAAAAGTGGCTCCCCGC NGG
678941 Deletion 11 118482441 118482441 AG A TTTACAGGGATACTTGGGCG CCAAGTATCC GAGCAAACAAAAAAAGTGGCTCCCCGC NGG
678941 Deletion 11 118482441 118482441 AG A TTTACAGGGATACTTGGGCG CCAAGTATCCC GCAAACAAAAAAAGTGGCTCCCCGC NGG
678941 Deletion 11 118482441 118482441 AG A TTTACAGGGATACTTGGGCG CCAAGTATCC AGAGCAGAGCAAACAAAAAAAGTGGCTCCCCGC NGG
408281 Deletion 11 118488714 118488714 CG C GCGCCCTCTGGAGGACCAGC GGTCCTCCAGAGG TGCAAGACGACAACACCAATTTTCCAGCT NGG
408281 Deletion 11 118488714 118488714 CG C GGAGAACGAGCGCCCTCTGG GAGGGCGC TGCAAGACGACAACACCAATTTTCCAGCTGGTCCTCCA NGG
408281 Deletion 11 118488714 118488714 CG C GCGCCCTCTGGAGGACCAGC GGTCCTCCAGAGG TTGCAAGACGACAACACCAATTTTCCAGCT NGG
408281 Deletion 11 118488714 118488714 CG C GCGCCCTCTGGAGGACCAGC GGTCCTCCAGAGGG TGCAAGACGACAACACCAATTTTCCAGCT NGG
408281 Deletion 11 118488714 118488714 CG C TGGAGGACCAGCTGGAAAAT TTCCAGCTGGTC TGCAAGACGACAACACCAATT NGG
408281 Deletion 11 118488714 118488714 CG C TGGAGGACCAGCTGGAAAAT TTCCAGCTGGT TGCAAGACGACAACACCAATT NGG
408281 Deletion 11 118488714 118488714 CG C GCGCCCTCTGGAGGACCAGC GGTCCTCCAGAGGG TTGCAAGACGACAACACCAATTTTCCAGCT NGG
408281 Deletion 11 118488714 118488714 CG C GGAGAACGAGCGCCCTCTGG GAGGGCGC TTGCAAGACGACAACACCAATTTTCCAGCTGGTCCTCCA NGG
408281 Deletion 11 118488714 118488714 CG C GCGCCCTCTGGAGGACCAGC GGTCCTCCAGAG TGCAAGACGACAACACCAATTTTCCAGCT NGG
408281 Deletion 11 118488714 118488714 CG C TGGAGGACCAGCTGGAAAAT TTCCAGCTGGTCC TGCAAGACGACAACACCAATT NGG
408283 Deletion 11 118493168 118493168 TC T TCTTACTGAGGTCAGCAAAC TGCTGACCTC GGCTGCTATCATCCTGTT NGG
408283 Deletion 11 118493168 118493168 TC T TCTTACTGAGGTCAGCAAAC TGCTGACCTCAGT GGCTGCTATCATCCTGTT NGG
408283 Deletion 11 118493168 118493168 TC T TCTTACTGAGGTCAGCAAAC TGCTGACCTCAGTA GGCTGCTATCATCCTGTT NGG
408283 Deletion 11 118493168 118493168 TC T TCTTACTGAGGTCAGCAAAC TGCTGACCTC GCTGCTATCATCCTGTT NGG
408283 Deletion 11 118493168 118493168 TC T TCTTACTGAGGTCAGCAAAC TGCTGACCTCA GGCTGCTATCATCCTGTT NGG
408283 Deletion 11 118493168 118493168 TC T TCTTACTGAGGTCAGCAAAC TGCTGACCTCAG GGCTGCTATCATCCTGTT NGG
408283 Deletion 11 118493168 118493168 TC T TCTTACTGAGGTCAGCAAAC TGCTGACCTCAGTAA GGCTGCTATCATCCTGTT NGG
408283 Deletion 11 118493168 118493168 TC T TCTTACTGAGGTCAGCAAAC TGCTGACCTCA GCTGCTATCATCCTGTT NGG
408283 Deletion 11 118493168 118493168 TC T TCTTACTGAGGTCAGCAAAC TGCTGACCTCAGT AGGCTGCTATCATCCTGTT NGG
408283 Deletion 11 118493168 118493168 TC T CCTTCCCGCAGCTCCCCCGA GGGGAGCTGCGGGA TCTAGATCTAAAGGCTGCTATCATCCTGTTTGCTGACCTCAGTAAGAACTGGTGGATCAGGTCCTTCG NGG
973782 Deletion 11 118496359 118496359 CA C TGTGCGTTATGTTTGACTTA GTCAAACATAACG AGCACGTCATCACCATAA NGG
973782 Deletion 11 118496359 118496359 CA C TGTGCGTTATGTTTGACTTA GTCAAACATAACGC AGCACGTCATCACCATAA NGG
973782 Deletion 11 118496359 118496359 CA C TGTGCGTTATGTTTGACTTA GTCAAACATAAC AGCACGTCATCACCATAA NGG
973782 Deletion 11 118496359 118496359 CA C TGTGCGTTATGTTTGACTTA GTCAAACATAACG TAGCACGTCATCACCATAA NGG
973782 Deletion 11 118496359 118496359 CA C TGTGCGTTATGTTTGACTTA GTCAAACATAACGCA AGCACGTCATCACCATAA NGG
973782 Deletion 11 118496359 118496359 CA C TGTGCGTTATGTTTGACTTA GTCAAACATAACGC TAGCACGTCATCACCATAA NGG
973782 Deletion 11 118496359 118496359 CA C TGTGCGTTATGTTTGACTTA GTCAAACATAAC TAGCACGTCATCACCATAA NGG
973782 Deletion 11 118496359 118496359 CA C TGTGCGTTATGTTTGACTTA GTCAAACATAACGCA TAGCACGTCATCACCATAA NGG
973782 Deletion 11 118496359 118496359 CA C TGTGCGTTATGTTTGACTTA GTCAAACATAACG TTAGCACGTCATCACCATAA NGG
973782 Deletion 11 118496359 118496359 CA C TGTGCGTTATGTTTGACTTA GTCAAACATAACGC TTAGCACGTCATCACCATAA NGG
1163191 Deletion 11 118498386 118498386 CA C GGATGTGAGACAGCAACCCA GTTGCTGTCTCAC CTGCCAAAGCCAGGAGCCACCGTGG NGG
1163191 Deletion 11 118498386 118498386 CA C GGATGTGAGACAGCAACCCA GTTGCTGTCTCACA CTGCCAAAGCCAGGAGCCACCGTGG NGG
1163191 Deletion 11 118498386 118498386 CA C GGATGTGAGACAGCAACCCA GTTGCTGTCTC CTGCCAAAGCCAGGAGCCACCGTGG NGG
1163191 Deletion 11 118498386 118498386 CA C GGATGTGAGACAGCAACCCA GTTGCTGTCTCACATC CTGCCAAAGCCAGGAGCCACCGTGG NGG
1163191 Deletion 11 118498386 118498386 CA C GGATGTGAGACAGCAACCCA GTTGCTGTCTCA CTGCCAAAGCCAGGAGCCACCGTGG NGG
1163191 Deletion 11 118498386 118498386 CA C GGATGTGAGACAGCAACCCA GTTGCTGTCTCACAT CTGCCAAAGCCAGGAGCCACCGTGG NGG
1163191 Deletion 11 118498386 118498386 CA C GGATGTGAGACAGCAACCCA GTTGCTGTCTCAC TCTGCCAAAGCCAGGAGCCACCGTGG NGG
1163191 Deletion 11 118498386 118498386 CA C GGATGTGAGACAGCAACCCA GTTGCTGTCTCACATCCT CTGCCAAAGCCAGGAGCCACCGTGG NGG
1163191 Deletion 11 118498386 118498386 CA C GGATGTGAGACAGCAACCCA GTTGCTGTCTCACATCC CTGCCAAAGCCAGGAGCCACCGTGG NGG
1163191 Deletion 11 118498386 118498386 CA C GGATGTGAGACAGCAACCCA GTTGCTGTCTCACA TCTGCCAAAGCCAGGAGCCACCGTGG NGG
362438 Deletion 11 118499340 118499343 GTGTT G TTTAAGGTGGTTCCTGAGAA TCAGGAACCACC CCACACTCTTCTGAAAACTTCAAATCCATTC NGG
362438 Deletion 11 118499340 118499343 GTGTT G TTTAAGGTGGTTCCTGAGAA TCAGGAACCACC TCCACACTCTTCTGAAAACTTCAAATCCATTC NGG
362438 Deletion 11 118499340 118499343 GTGTT G TTTAAGGTGGTTCCTGAGAA TCAGGAACCACC GTCCACACTCTTCTGAAAACTTCAAATCCATTC NGG
362438 Deletion 11 118499340 118499343 GTGTT G TTTAAGGTGGTTCCTGAGAA TCAGGAACCACC AGTCCACACTCTTCTGAAAACTTCAAATCCATTC NGG
362438 Deletion 11 118499340 118499343 GTGTT G TTTAAGGTGGTTCCTGAGAA TCAGGAACC CCACACTCTTCTGAAAACTTCAAATCCATTC NGG
362438 Deletion 11 118499340 118499343 GTGTT G TTTAAGGTGGTTCCTGAGAA TCAGGAACC TCCACACTCTTCTGAAAACTTCAAATCCATTC NGG
362438 Deletion 11 118499340 118499343 GTGTT G TTTAAGGTGGTTCCTGAGAA TCAGGAACCACC AAGTCCACACTCTTCTGAAAACTTCAAATCCATTC NGG
362438 Deletion 11 118499340 118499343 GTGTT G TTTAAGGTGGTTCCTGAGAA TCAGGAACCAC CCACACTCTTCTGAAAACTTCAAATCCATTC NGG
362438 Deletion 11 118499340 118499343 GTGTT G TTTAAGGTGGTTCCTGAGAA TCAGGAACCAC TCCACACTCTTCTGAAAACTTCAAATCCATTC NGG
362438 Deletion 11 118499340 118499343 GTGTT G TTTAAGGTGGTTCCTGAGAA TCAGGAACC GTCCACACTCTTCTGAAAACTTCAAATCCATTC NGG
514619 Deletion 11 118501132 118501132 TC T GACTAACCTGTAAAAGATGT TCTTTTACAGG CATAGTCAACA NGG
514619 Deletion 11 118501132 118501132 TC T GACTAACCTGTAAAAGATGT TCTTTTACAGGT CATAGTCAACA NGG
514619 Deletion 11 118501132 118501132 TC T GACTAACCTGTAAAAGATGT TCTTTTACAGGTTAGT CATAGTCAACA NGG
514619 Deletion 11 118501132 118501132 TC T GACTAACCTGTAAAAGATGT TCTTTTACAGGTTAG CATAGTCAACA NGG
514619 Deletion 11 118501132 118501132 TC T GACTAACCTGTAAAAGATGT TCTTTTACAGG CCATAGTCAACA NGG
514619 Deletion 11 118501132 118501132 TC T GACTAACCTGTAAAAGATGT TCTTTTACAGGTTAGTCT CATAGTCAACA NGG
514619 Deletion 11 118501132 118501132 TC T GACTAACCTGTAAAAGATGT TCTTTTACAGGTT CATAGTCAACA NGG
514619 Deletion 11 118501132 118501132 TC T GACTAACCTGTAAAAGATGT TCTTTTACAGGTTAGTC CATAGTCAACA NGG
514619 Deletion 11 118501132 118501132 TC T GACTAACCTGTAAAAGATGT TCTTTTACAGGT CCATAGTCAACA NGG
514619 Deletion 11 118501132 118501132 TC T GACTAACCTGTAAAAGATGT TCTTTTACAGGTTA CATAGTCAACA NGG
207816 Deletion 11 118502701 118502701 CA C CCACCTCTTCAAATTTGCAA CAAATTTGAAGAGGTGGA AGTAACCACTGTCCTTG NGG
207816 Deletion 11 118502701 118502701 CA C CCACCTCTTCAAATTTGCAA CAAATTTGAAGAGGTGGA CACTGTCCTTG NGG
207816 Deletion 11 118502701 118502701 CA C CCACCTCTTCAAATTTGCAA CAAATTTGAAGAGGTGGA GTAACCACTGTCCTTG NGG
207816 Deletion 11 118502701 118502701 CA C CCACCTCTTCAAATTTGCAA CAAATTTGAAGAGGTGG AGTAACCACTGTCCTTG NGG
207816 Deletion 11 118502701 118502701 CA C CCACCTCTTCAAATTTGCAA CAAATTTGAAGAGGTGG GTAACCACTGTCCTTG NGG
207816 Deletion 11 118502701 118502701 CA C CCACCTCTTCAAATTTGCAA CAAATTTGAAGAGGTGG CACTGTCCTTG NGG
207816 Deletion 11 118502701 118502701 CA C CCACCTCTTCAAATTTGCAA CAAATTTGAAGAGGTGGA CAGTAACCACTGTCCTTG NGG
207816 Deletion 11 118502701 118502701 CA C CCACCTCTTCAAATTTGCAA CAAATTTGAAGAGGTGGA CCACTGTCCTTG NGG
207816 Deletion 11 118502701 118502701 CA C CCACCTCTTCAAATTTGCAA CAAATTTGAAGAGGTGGA ACAGTAACCACTGTCCTTG NGG
207816 Deletion 11 118502701 118502701 CA C CCACCTCTTCAAATTTGCAA CAAATTTGAAGAGGTGGA TAACCACTGTCCTTG NGG
45749 Deletion 11 118502805 118502805 CT C GGTCTTCTCTCCCTTTAAAG TAAAGGGAGAGA GTGTCCAAGAGCTCCCTT NGG
45749 Deletion 11 118502805 118502805 CT C GGTCTTCTCTCCCTTTAAAG TAAAGGGAGAG GTGTCCAAGAGCTCCCTT NGG
45749 Deletion 11 118502805 118502805 CT C GCAGTCCAGTGCTTCAGACT CTGAAGCAC TAAAGGGAGCTCTTGGACACCAAGT NGG
45749 Deletion 11 118502805 118502805 CT C GGTCTTCTCTCCCTTTAAAG TAAAGGGAGAG TGTCCAAGAGCTCCCTT NGG
45749 Deletion 11 118502805 118502805 CT C GGTCTTCTCTCCCTTTAAAG TAAAGGGAGAGA TGTCCAAGAGCTCCCTT NGG
45749 Deletion 11 118502805 118502805 CT C GCAGTCCAGTGCTTCAGACT CTGAAGCAC CCTCTGAGCTCTTGGAACTCAGCACTTTGGTCTTCTCTCCCTTTAAAGGGAGCTCTTGGACACCAAGT NGG
45749 Deletion 11 118502805 118502805 CT C GGTCTTCTCTCCCTTTAAAG TAAAGGGAGAGA GGTGTCCAAGAGCTCCCTT NGG
45749 Deletion 11 118502805 118502805 CT C GCAGTCCAGTGCTTCAGACT CTGAAGCAC CTCTGAGCTCTTGGAACTCAGCACTTTGGTCTTCTCTCCCTTTAAAGGGAGCTCTTGGACACCAAGT NGG
45749 Deletion 11 118502805 118502805 CT C GGTCTTCTCTCCCTTTAAAG TAAAGGGAGAGAA GTGTCCAAGAGCTCCCTT NGG
45749 Deletion 11 118502805 118502805 CT C GGTCTTCTCTCCCTTTAAAG TAAAGGGAGAG GGTGTCCAAGAGCTCCCTT NGG
980711 Deletion 11 118502912 118502912 AC A AATTCCTAAACTGGCCCCAC GGGCCAGTTTAGGAA GTTGTTTATGAACCTGTG NGG
980711 Deletion 11 118502912 118502912 AC A AATTCCTAAACTGGCCCCAC GGGCCAGTTTAGGA GTTGTTTATGAACCTGTG NGG
980711 Deletion 11 118502912 118502912 AC A AATTCCTAAACTGGCCCCAC GGGCCAGTTTAGGAAT GTTGTTTATGAACCTGTG NGG
980711 Deletion 11 118502912 118502912 AC A AATTCCTAAACTGGCCCCAC GGGCCAGTTTAGGAATT GTTGTTTATGAACCTGTG NGG
980711 Deletion 11 118502912 118502912 AC A AATTCCTAAACTGGCCCCAC GGGCCAGTTTAGG GTTGTTTATGAACCTGTG NGG
980711 Deletion 11 118502912 118502912 AC A AATTCCTAAACTGGCCCCAC GGGCCAGTTTAGGAATTC GTTGTTTATGAACCTGTG NGG
980711 Deletion 11 118502912 118502912 AC A AATTCCTAAACTGGCCCCAC GGGCCAGT GTTGTTTATGAACCTGTG NGG
980711 Deletion 11 118502912 118502912 AC A AATTCCTAAACTGGCCCCAC GGGCCAGTTTAGGA TGTTGTTTATGAACCTGTG NGG
980711 Deletion 11 118502912 118502912 AC A AATTCCTAAACTGGCCCCAC GGGCCAGTTTAGGAA TGTTGTTTATGAACCTGTG NGG
980711 Deletion 11 118502912 118502912 AC A AATTCCTAAACTGGCCCCAC GGGCCAGTTTAGGAAT TGTTGTTTATGAACCTGTG NGG
805667 Deletion 11 118502961 118502961 AC A GAAGAAAACGACACTGAAGA TCAGTGTCGT CTGAACCTCT NGG
805667 Deletion 11 118502961 118502961 AC A GAAGAAAACGACACTGAAGA TCAGTGTCG CTGAACCTCT NGG
805667 Deletion 11 118502961 118502961 AC A GAAGAAAACGACACTGAAGA TCAGTGTCGTT CTGAACCTCT NGG
805667 Deletion 11 118502961 118502961 AC A AGAAGAAAACGACACTGAAG CAGTGTCGT CTGAACCTCTT NGG
805667 Deletion 11 118502961 118502961 AC A AGAAGAAAACGACACTGAAG CAGTGTCGTT CTGAACCTCTT NGG
805667 Deletion 11 118502961 118502961 AC A GAAGAAAACGACACTGAAGA TCAGTGTCGTTT CTGAACCTCT NGG
805667 Deletion 11 118502961 118502961 AC A GAAGAAAACGACACTGAAGA TCAGTGTC CTGAACCTCT NGG
805667 Deletion 11 118502961 118502961 AC A AGAAGAAAACGACACTGAAG CAGTGTCG CTGAACCTCTT NGG
805667 Deletion 11 118502961 118502961 AC A GAAGAAAACGACACTGAAGA TCAGTGTCGT GCTGAACCTCT NGG
805667 Deletion 11 118502961 118502961 AC A AGAAGAAAACGACACTGAAG CAGTGTCGTTT CTGAACCTCTT NGG
805668 Deletion 11 118503014 118503014 AT A CATTCCTTTGCCCTCTCAAA GAGAGGGC CACCTCCATT NGG
805668 Deletion 11 118503014 118503014 AT A CATTCCTTTGCCCTCTCAAA GAGAGGGCA CACCTCCATT NGG
805668 Deletion 11 118503014 118503014 AT A CATTCCTTTGCCCTCTCAAA GAGAGGGC CACACCTCCATT NGG
805668 Deletion 11 118503014 118503014 AT A CATTCCTTTGCCCTCTCAAA GAGAGGGCA CACACCTCCATT NGG
805668 Deletion 11 118503014 118503014 AT A CATTCCTTTGCCCTCTCAAA GAGAGGGC ACACCTCCATT NGG
805668 Deletion 11 118503014 118503014 AT A CATTCCTTTGCCCTCTCAAA GAGAGGGC TTCCCACACCTCCATT NGG
805668 Deletion 11 118503014 118503014 AT A CATTCCTTTGCCCTCTCAAA GAGAGGGCA ACACCTCCATT NGG
805668 Deletion 11 118503014 118503014 AT A CATTCCTTTGCCCTCTCAAA GAGAGGGC CCTCCATT NGG
805668 Deletion 11 118503014 118503014 AT A CATTCCTTTGCCCTCTCAAA GAGAGGGCA CCTCCATT NGG
805668 Deletion 11 118503014 118503014 AT A CATTCCTTTGCCCTCTCAAA GAGAGGGCAA CACCTCCATT NGG
805670 Deletion 11 118503236 118503236 CT C TCACCAGTTGTCACCTGACC CAGGTGACAACTGG AAATCTTTTTGGAACCTGGT NGG
805670 Deletion 11 118503236 118503236 CT C TCACCAGTTGTCACCTGACC CAGGTGACAAC AAATCTTTTTGGAACCTGGT NGG
805670 Deletion 11 118503236 118503236 CT C TCACCAGTTGTCACCTGACC CAGGTGACAACTGGT AAATCTTTTTGGAACCTGGT NGG
805670 Deletion 11 118503236 118503236 CT C TCACCAGTTGTCACCTGACC CAGGTGACAACT AAATCTTTTTGGAACCTGGT NGG
805670 Deletion 11 118503236 118503236 CT C TCACCAGTTGTCACCTGACC CAGGTGACAACTG AAATCTTTTTGGAACCTGGT NGG
805670 Deletion 11 118503236 118503236 CT C TCACCAGTTGTCACCTGACC CAGGTGACAACTGGTG AAATCTTTTTGGAACCTGGT NGG
805670 Deletion 11 118503236 118503236 CT C TCACCAGTTGTCACCTGACC CAGGTGACAACTGG TAAATCTTTTTGGAACCTGGT NGG
805670 Deletion 11 118503236 118503236 CT C TCACCAGTTGTCACCTGACC CAGGTGACAAC AAAGGGAAAAAATCCTGTAAAGAAACTTTCAAAGAAAAGCATTCCAGTAAATCTTTTTGGAACCTGGT NGG
805670 Deletion 11 118503236 118503236 CT C TCACCAGTTGTCACCTGACC CAGGTGACAAC AAGGGAAAAAATCCTGTAAAGAAACTTTCAAAGAAAAGCATTCCAGTAAATCTTTTTGGAACCTGGT NGG
805670 Deletion 11 118503236 118503236 CT C TCACCAGTTGTCACCTGACC CAGGTGACAAC AGGGAAAAAATCCTGTAAAGAAACTTTCAAAGAAAAGCATTCCAGTAAATCTTTTTGGAACCTGGT NGG
511897 Deletion 11 118503389 118503389 GA G TACTTGCATGGGTGGAGCTT CTCCACCC GCCAGGGTCCCCAAAG NGG
511897 Deletion 11 118503389 118503389 GA G GGTGGAGCTTTGGGGACTCC GTCCCCAA CTATGCCAGG NGG
511897 Deletion 11 118503389 118503389 GA G TACTTGCATGGGTGGAGCTT CTCCACCC TGCCAGGGTCCCCAAAG NGG
511897 Deletion 11 118503389 118503389 GA G TACTTGCATGGGTGGAGCTT CTCCACCC ATGCCAGGGTCCCCAAAG NGG
511897 Deletion 11 118503389 118503389 GA G TACTTGCATGGGTGGAGCTT CTCCACCCA GCCAGGGTCCCCAAAG NGG
511897 Deletion 11 118503389 118503389 GA G GGTGGAGCTTTGGGGACTCC GTCCCCAAA CTATGCCAGG NGG
511897 Deletion 11 118503389 118503389 GA G GGTGGAGCTTTGGGGACTCC GTCCCCAAAG CTATGCCAGG NGG
511897 Deletion 11 118503389 118503389 GA G TACTTGCATGGGTGGAGCTT CTCCACCCA TGCCAGGGTCCCCAAAG NGG
511897 Deletion 11 118503389 118503389 GA G TACTTGCATGGGTGGAGCTT CTCCACCC TATGCCAGGGTCCCCAAAG NGG
511897 Deletion 11 118503389 118503389 GA G GGTGGAGCTTTGGGGACTCC GTCCCCAAAGC CTATGCCAGG NGG
1053771 Deletion 11 118503488 118503488 TG T CCAAGGAATTACAGGCACCA TGCCTGTAATTCC TTGGATTGACTCTCATTTTCATTTTTAGAGGTGTCAGTGTCACTTTGACTGTGCGTTTCCGTGG NGG
1053771 Deletion 11 118503488 118503488 TG T CCAAGGAATTACAGGCACCA TGCCTGTAATTCC TGGATTGACTCTCATTTTCATTTTTAGAGGTGTCAGTGTCACTTTGACTGTGCGTTTCCGTGG NGG
1053771 Deletion 11 118503488 118503488 TG T CCAAGGAATTACAGGCACCA TGCCTGTAATTCC TTTGGATTGACTCTCATTTTCATTTTTAGAGGTGTCAGTGTCACTTTGACTGTGCGTTTCCGTGG NGG
1053771 Deletion 11 118503488 118503488 TG T CCAAGGAATTACAGGCACCA TGCCTGTAATTCC GGATTGACTCTCATTTTCATTTTTAGAGGTGTCAGTGTCACTTTGACTGTGCGTTTCCGTGG NGG
1053771 Deletion 11 118503488 118503488 TG T CCAAGGAATTACAGGCACCA TGCCTGTAATTCCT TTGGATTGACTCTCATTTTCATTTTTAGAGGTGTCAGTGTCACTTTGACTGTGCGTTTCCGTGG NGG
1053771 Deletion 11 118503488 118503488 TG T CCAAGGAATTACAGGCACCA TGCCTGTAATTCCT TGGATTGACTCTCATTTTCATTTTTAGAGGTGTCAGTGTCACTTTGACTGTGCGTTTCCGTGG NGG
1053771 Deletion 11 118503488 118503488 TG T CCAAGGAATTACAGGCACCA TGCCTGTAATTCC TTTTGGATTGACTCTCATTTTCATTTTTAGAGGTGTCAGTGTCACTTTGACTGTGCGTTTCCGTGG NGG
1053771 Deletion 11 118503488 118503488 TG T GACACTGACACCTCTAAAAA TTAGAGGTGTC CATTTTCATTT NGG
1053771 Deletion 11 118503488 118503488 TG T CCAAGGAATTACAGGCACCA TGCCTGTAATTCCT TTTGGATTGACTCTCATTTTCATTTTTAGAGGTGTCAGTGTCACTTTGACTGTGCGTTTCCGTGG NGG
1053771 Deletion 11 118503488 118503488 TG T CCAAGGAATTACAGGCACCA TGCCTGTAATTCCT GGATTGACTCTCATTTTCATTTTTAGAGGTGTCAGTGTCACTTTGACTGTGCGTTTCCGTGG NGG
791110 Deletion 11 118503535 118503535 GC G TCTATTTGCAAAGGGGAAGC TCCCCTTTGC AGTAGTCCTGT NGG
791110 Deletion 11 118503535 118503535 GC G TCTATTTGCAAAGGGGAAGC TCCCCTTTGCA AGTAGTCCTGT NGG
791110 Deletion 11 118503535 118503535 GC G GATGTTGACTCTATTTGCAA CAAATAGAGTCAAC GTCCTGTTCCCCTTTG NGG
791110 Deletion 11 118503535 118503535 GC G TCTATTTGCAAAGGGGAAGC TCCCCTTTGC GTAGTCCTGT NGG
791110 Deletion 11 118503535 118503535 GC G TCTATTTGCAAAGGGGAAGC TCCCCTTTGCAAATAGAG AGTAGTCCTGT NGG
791110 Deletion 11 118503535 118503535 GC G TCTATTTGCAAAGGGGAAGC TCCCCTTTGCAAATAGA AGTAGTCCTGT NGG
791110 Deletion 11 118503535 118503535 GC G GATGTTGACTCTATTTGCAA CAAATAGAGTCAACA GTCCTGTTCCCCTTTG NGG
791110 Deletion 11 118503535 118503535 GC G GATGTTGACTCTATTTGCAA CAAATAGAGTCAAC TCCTGTTCCCCTTTG NGG
791110 Deletion 11 118503535 118503535 GC G GATGTTGACTCTATTTGCAA CAAATAGAGTCAA GTCCTGTTCCCCTTTG NGG
791110 Deletion 11 118503535 118503535 GC G TCTATTTGCAAAGGGGAAGC TCCCCTTTGCAAATAG AGTAGTCCTGT NGG
975305 Deletion 11 118503733 118503733 TC T GGCCCCAAACCTCAGGAGGA TCCTGAGGT TTAAAAAGCCATCC NGG
975305 Deletion 11 118503733 118503733 TC T GGCCCCAAACCTCAGGAGGA TCCTGAGGT TAAAAAGCCATCC NGG
975305 Deletion 11 118503733 118503733 TC T GGCCCCAAACCTCAGGAGGA TCCTGAGG TAAAAAGCCATCC NGG
975305 Deletion 11 118503733 118503733 TC T GGCCCCAAACCTCAGGAGGA TCCTGAGG TTAAAAAGCCATCC NGG
975305 Deletion 11 118503733 118503733 TC T GGCCCCAAACCTCAGGAGGA TCCTGAGGTT TAAAAAGCCATCC NGG
975305 Deletion 11 118503733 118503733 TC T GGCCCCAAACCTCAGGAGGA TCCTGAGGTT TTAAAAAGCCATCC NGG
975305 Deletion 11 118503733 118503733 TC T GGCCCCAAACCTCAGGAGGA TCCTGAGGT TTTAAAAAGCCATCC NGG
975305 Deletion 11 118503733 118503733 TC T GGCCCCAAACCTCAGGAGGA TCCTGAGG TTTAAAAAGCCATCC NGG
975305 Deletion 11 118503733 118503733 TC T GGCCCCAAACCTCAGGAGGA TCCTGAGGTT TTTAAAAAGCCATCC NGG
975305 Deletion 11 118503733 118503733 TC T GGCCCCAAACCTCAGGAGGA TCCTGAGGTTT TAAAAAGCCATCC NGG
791111 Deletion 11 118503789 118503789 TG T AGGATCTTACTCCATAGAGT CTATGGAGTA TTTTTGGCTTACCCCACT NGG
791111 Deletion 11 118503789 118503789 TG T AGGATCTTACTCCATAGAGT CTATGGAGTAA TTTTTGGCTTACCCCACT NGG
791111 Deletion 11 118503789 118503789 TG T AGGATCTTACTCCATAGAGT CTATGGAGT TTTTTGGCTTACCCCACT NGG
791111 Deletion 11 118503789 118503789 TG T AGGATCTTACTCCATAGAGT CTATGGAGTAAG TTTTTGGCTTACCCCACT NGG
791111 Deletion 11 118503789 118503789 TG T AGGATCTTACTCCATAGAGT CTATGGAGTAAGA TTTTTGGCTTACCCCACT NGG
791111 Deletion 11 118503789 118503789 TG T AGGATCTTACTCCATAGAGT CTATGGAGTAAGAT TTTTTGGCTTACCCCACT NGG
791111 Deletion 11 118503789 118503789 TG T AGGATCTTACTCCATAGAGT CTATGGAG TTTTTGGCTTACCCCACT NGG
791111 Deletion 11 118503789 118503789 TG T AGGATCTTACTCCATAGAGT CTATGGAGTAAGATC TTTTTGGCTTACCCCACT NGG
791111 Deletion 11 118503789 118503789 TG T AGGATCTTACTCCATAGAGT CTATGGAGTAAGA TTTTTTGGCTTACCCCACT NGG
791111 Deletion 11 118503789 118503789 TG T AGGATCTTACTCCATAGAGT CTATGGAGTAAG TTTTTTGGCTTACCCCACT NGG
956402 Deletion 11 118503817 118503817 TC T TGGAATGTCTTCTTCACCAT GTGAAGAAGAC AGTAAGATCTATG NGG
956402 Deletion 11 118503817 118503817 TC T TGGAATGTCTTCTTCACCAT GTGAAGAAGAC GTAAGATCTATG NGG
956402 Deletion 11 118503817 118503817 TC T TGGAATGTCTTCTTCACCAT GTGAAGAAGA AGTAAGATCTATG NGG
956402 Deletion 11 118503817 118503817 TC T TGGAATGTCTTCTTCACCAT GTGAAGAAGACA AGTAAGATCTATG NGG
956402 Deletion 11 118503817 118503817 TC T TGGAATGTCTTCTTCACCAT GTGAAGAAGACA GTAAGATCTATG NGG
956402 Deletion 11 118503817 118503817 TC T TGGAATGTCTTCTTCACCAT GTGAAGAAGA GTAAGATCTATG NGG
956402 Deletion 11 118503817 118503817 TC T TGGAATGTCTTCTTCACCAT GTGAAGAAGAC GAGTAAGATCTATG NGG
956402 Deletion 11 118503817 118503817 TC T TGGAATGTCTTCTTCACCAT GTGAAGAAGACAT GTAAGATCTATG NGG
956402 Deletion 11 118503817 118503817 TC T TGGAATGTCTTCTTCACCAT GTGAAGAAGAC GGAGTAAGATCTATG NGG
956402 Deletion 11 118503817 118503817 TC T TGGAATGTCTTCTTCACCAT GTGAAGAAGACAT AGTAAGATCTATG NGG
424489 Deletion 11 118504037 118504037 CA C CCATCCAACTGTGAGATTTT ATCTCACAGTTGGA GTGTGATCTTCCAAA NGG
424489 Deletion 11 118504037 118504037 CA C CCATCCAACTGTGAGATTTT ATCTCACAGTTGGA AGTGTGATCTTCCAAA NGG
424489 Deletion 11 118504037 118504037 CA C CCATCCAACTGTGAGATTTT ATCTCACAGTTGG GTGTGATCTTCCAAA NGG
424489 Deletion 11 118504037 118504037 CA C CCATCCAACTGTGAGATTTT ATCTCACAGTTGGA GTGATCTTCCAAA NGG
424489 Deletion 11 118504037 118504037 CA C CCATCCAACTGTGAGATTTT ATCTCACAGTTGGAT GTGTGATCTTCCAAA NGG
424489 Deletion 11 118504037 118504037 CA C CCATCCAACTGTGAGATTTT ATCTCACAGTTGGA TGTGATCTTCCAAA NGG
424489 Deletion 11 118504037 118504037 CA C CCATCCAACTGTGAGATTTT ATCTCACAGTTGG AGTGTGATCTTCCAAA NGG
424489 Deletion 11 118504037 118504037 CA C CCATCCAACTGTGAGATTTT ATCTCACAGTTGGAT AGTGTGATCTTCCAAA NGG
424489 Deletion 11 118504037 118504037 CA C CCATCCAACTGTGAGATTTT ATCTCACAGTTGG GTGATCTTCCAAA NGG
424489 Deletion 11 118504037 118504037 CA C CCATCCAACTGTGAGATTTT ATCTCACAGTTGGA CAGTGTGATCTTCCAAA NGG
45748 Deletion 11 118504158 118504158 CT C TCTTTCTCCCCAGCATCTTC GATGCTGGGGAGAA TGGAACAGAGAACTAAAGATTGATAGACCTGAA NGG
45748 Deletion 11 118504158 118504158 CT C TCTTTCTCCCCAGCATCTTC GATGCTGGGGAGA TGGAACAGAGAACTAAAGATTGATAGACCTGAA NGG
45748 Deletion 11 118504158 118504158 CT C TCTTTCTCCCCAGCATCTTC GATGCTGGGGAGAA GGAACAGAGAACTAAAGATTGATAGACCTGAA NGG
45748 Deletion 11 118504158 118504158 CT C TCTTTCTCCCCAGCATCTTC GATGCTGGGGAGA GGAACAGAGAACTAAAGATTGATAGACCTGAA NGG
45748 Deletion 11 118504158 118504158 CT C TCTTTCTCCCCAGCATCTTC GATGCTGGGGAGAA ATGGAACAGAGAACTAAAGATTGATAGACCTGAA NGG
45748 Deletion 11 118504158 118504158 CT C TCTTTCTCCCCAGCATCTTC GATGCTGGGGAGA ATGGAACAGAGAACTAAAGATTGATAGACCTGAA NGG
45748 Deletion 11 118504158 118504158 CT C TCTTTCTCCCCAGCATCTTC GATGCTGGGGAGAA GAGAACTAAAGATTGATAGACCTGAA NGG
45748 Deletion 11 118504158 118504158 CT C TCTTTCTCCCCAGCATCTTC GATGCTGGGGAGA GAGAACTAAAGATTGATAGACCTGAA NGG
45748 Deletion 11 118504158 118504158 CT C TCTTTCTCCCCAGCATCTTC GATGCTGGGGAGAA AGAGAACTAAAGATTGATAGACCTGAA NGG
45748 Deletion 11 118504158 118504158 CT C TCTTTCTCCCCAGCATCTTC GATGCTGGGGAGA AGAGAACTAAAGATTGATAGACCTGAA NGG
805671 Deletion 11 118504342 118504342 AC A CAGTAAATTTTTGTCGGAGG CCGACAAAAATTTACTGG CAAGTACCCCT NGG
805671 Deletion 11 118504342 118504342 AC A CAGTAAATTTTTGTCGGAGG CCGACAAAAAT CAAGTACCCCT NGG
805671 Deletion 11 118504342 118504342 AC A CAGTAAATTTTTGTCGGAGG CCGACAAAA CAAGTACCCCT NGG
805671 Deletion 11 118504342 118504342 AC A CAGTAAATTTTTGTCGGAGG CCGACAAA CAAGTACCCCT NGG
805671 Deletion 11 118504342 118504342 AC A CAGTAAATTTTTGTCGGAGG CCGACAAAAA CAAGTACCCCT NGG
805671 Deletion 11 118504342 118504342 AC A CCAGTAAATTTTTGTCGGAG CGACAAAAATTTACTGGA CAAGTACCCCTC NGG
805671 Deletion 11 118504342 118504342 AC A CCAGTAAATTTTTGTCGGAG CGACAAAAATTTACTGG CAAGTACCCCTC NGG
805671 Deletion 11 118504342 118504342 AC A CAGTAAATTTTTGTCGGAGG CCGACAAAAATT CAAGTACCCCT NGG
805671 Deletion 11 118504342 118504342 AC A CAGTAAATTTTTGTCGGAGG CCGACAAAAATTTACTG CAAGTACCCCT NGG
805671 Deletion 11 118504342 118504342 AC A CAGTAAATTTTTGTCGGAGG CCGACAAAAATTTACT CAAGTACCCCT NGG
985745 Deletion 11 118504658 118504659 AAC A CTCTTCCTCTATCTCAGCAG CTGAGATAGAGGAAG GAGGCAACTCAAACTTCCTCTG NGG
985745 Deletion 11 118504658 118504659 AAC A CTCTTCCTCTATCTCAGCAG CTGAGATAGAGGAA GGCAACTCAAACTTCCTCTG NGG
985745 Deletion 11 118504658 118504659 AAC A CTCTTCCTCTATCTCAGCAG CTGAGATAGAGGAA GAGGCAACTCAAACTTCCTCTG NGG
985745 Deletion 11 118504658 118504659 AAC A CTCTTCCTCTATCTCAGCAG CTGAGATAGAGGAAG GGCAACTCAAACTTCCTCTG NGG
985745 Deletion 11 118504658 118504659 AAC A CTCTTCCTCTATCTCAGCAG CTGAGATAGAGGAA GCAACTCAAACTTCCTCTG NGG
985745 Deletion 11 118504658 118504659 AAC A CTCTTCCTCTATCTCAGCAG CTGAGATAGAGGAAG AGGCAACTCAAACTTCCTCTG NGG
985745 Deletion 11 118504658 118504659 AAC A CTCTTCCTCTATCTCAGCAG CTGAGATAGAGGAA AGGCAACTCAAACTTCCTCTG NGG
985745 Deletion 11 118504658 118504659 AAC A CTCTTCCTCTATCTCAGCAG CTGAGATAGAGGAA AGAGGCAACTCAAACTTCCTCTG NGG
985745 Deletion 11 118504658 118504659 AAC A CTCTTCCTCTATCTCAGCAG CTGAGATAGAGGAAG AGAGGCAACTCAAACTTCCTCTG NGG
985745 Deletion 11 118504658 118504659 AAC A CTCTTCCTCTATCTCAGCAG CTGAGATAGAGGAAG GCAACTCAAACTTCCTCTG NGG
264412 Deletion 11 118504755 118504759 TATCTC T ATCTGTCTGTCTTGACCACC GGTCAAGACAGA CTCTCTTCTCCCCTGAGTCTAACAGCTAGTCTACTGGGATTCTGGCTGGGGACAGTGGGACTCCGGGT NGG
264412 Deletion 11 118504755 118504759 TATCTC T ATCTGTCTGTCTTGACCACC GGTCAAGACAGA TCTCTTCTCCCCTGAGTCTAACAGCTAGTCTACTGGGATTCTGGCTGGGGACAGTGGGACTCCGGGT NGG
264412 Deletion 11 118504755 118504759 TATCTC T ATCTGTCTGTCTTGACCACC GGTCAAGACAGA CTCTTCTCCCCTGAGTCTAACAGCTAGTCTACTGGGATTCTGGCTGGGGACAGTGGGACTCCGGGT NGG
264412 Deletion 11 118504755 118504759 TATCTC T ATCTGTCTGTCTTGACCACC GGTCAAGACAGAC CTCTCTTCTCCCCTGAGTCTAACAGCTAGTCTACTGGGATTCTGGCTGGGGACAGTGGGACTCCGGGT NGG
264412 Deletion 11 118504755 118504759 TATCTC T ATCTGTCTGTCTTGACCACC GGTCAAGACAGACA CTCTCTTCTCCCCTGAGTCTAACAGCTAGTCTACTGGGATTCTGGCTGGGGACAGTGGGACTCCGGGT NGG
264412 Deletion 11 118504755 118504759 TATCTC T ATCTGTCTGTCTTGACCACC GGTCAAGACAG CTCTCTTCTCCCCTGAGTCTAACAGCTAGTCTACTGGGATTCTGGCTGGGGACAGTGGGACTCCGGGT NGG
264412 Deletion 11 118504755 118504759 TATCTC T ATCTGTCTGTCTTGACCACC GGTCAAGACAGA TCTTCTCCCCTGAGTCTAACAGCTAGTCTACTGGGATTCTGGCTGGGGACAGTGGGACTCCGGGT NGG
264412 Deletion 11 118504755 118504759 TATCTC T ATCTGTCTGTCTTGACCACC GGTCAAGACAGA TCTCCCCTGAGTCTAACAGCTAGTCTACTGGGATTCTGGCTGGGGACAGTGGGACTCCGGGT NGG
264412 Deletion 11 118504755 118504759 TATCTC T ATCTGTCTGTCTTGACCACC GGTCAAGACAGAC TCTCTTCTCCCCTGAGTCTAACAGCTAGTCTACTGGGATTCTGGCTGGGGACAGTGGGACTCCGGGT NGG
264412 Deletion 11 118504755 118504759 TATCTC T ATCTGTCTGTCTTGACCACC GGTCAAGACAGACA TCTCTTCTCCCCTGAGTCTAACAGCTAGTCTACTGGGATTCTGGCTGGGGACAGTGGGACTCCGGGT NGG
980792 Deletion 11 118504960 118504960 CA C GGTTCAGTAGAGCAAGGTCA CCTTGCTC AATCCGATTGTTGCCATGA NGG
980792 Deletion 11 118504960 118504960 CA C GGTTCAGTAGAGCAAGGTCA CCTTGCTCT AATCCGATTGTTGCCATGA NGG
980792 Deletion 11 118504960 118504960 CA C GGTTCAGTAGAGCAAGGTCA CCTTGCTCTAC AATCCGATTGTTGCCATGA NGG
980792 Deletion 11 118504960 118504960 CA C GGTTCAGTAGAGCAAGGTCA CCTTGCTCTACTG AATCCGATTGTTGCCATGA NGG
980792 Deletion 11 118504960 118504960 CA C GGTTCAGTAGAGCAAGGTCA CCTTGCTCTACT AATCCGATTGTTGCCATGA NGG
980792 Deletion 11 118504960 118504960 CA C GGTTCAGTAGAGCAAGGTCA CCTTGCTCTACTGA AATCCGATTGTTGCCATGA NGG
980792 Deletion 11 118504960 118504960 CA C GGTTCAGTAGAGCAAGGTCA CCTTGCTC AAATCCGATTGTTGCCATGA NGG
980792 Deletion 11 118504960 118504960 CA C GGTTCAGTAGAGCAAGGTCA CCTTGCTCT AAATCCGATTGTTGCCATGA NGG
980792 Deletion 11 118504960 118504960 CA C GGTTCAGTAGAGCAAGGTCA CCTTGCTCTA AATCCGATTGTTGCCATGA NGG
980792 Deletion 11 118504960 118504960 CA C AACAGGTACCTGAAGGCCAG GCCTTCAGGTAC TGGCAACAATCGGATTTAACTAGGAACAGTAGCACCCCTG NGG
511898 Deletion 11 118505003 118505006 CTGTT C ATGGGAACAGTTGGGGAAAC TCCCCAACTG CTTCAGGTACC NGG
511898 Deletion 11 118505003 118505006 CTGTT C ATGGGAACAGTTGGGGAAAC TCCCCAAC CTTCAGGTACC NGG
511898 Deletion 11 118505003 118505006 CTGTT C ATGGGAACAGTTGGGGAAAC TCCCCAACT CTTCAGGTACC NGG
511898 Deletion 11 118505003 118505006 CTGTT C ATGGGAACAGTTGGGGAAAC TCCCCAACTGT CTTCAGGTACC NGG
511898 Deletion 11 118505003 118505006 CTGTT C ATGGGAACAGTTGGGGAAAC TCCCCAACTG TTCAGGTACC NGG
511898 Deletion 11 118505003 118505006 CTGTT C ATGGGAACAGTTGGGGAAAC TCCCCAACTG CCTTCAGGTACC NGG
511898 Deletion 11 118505003 118505006 CTGTT C ATGGGAACAGTTGGGGAAAC TCCCCAAC CCTTCAGGTACC NGG
511898 Deletion 11 118505003 118505006 CTGTT C ATGGGAACAGTTGGGGAAAC TCCCCAACT CCTTCAGGTACC NGG
511898 Deletion 11 118505003 118505006 CTGTT C ATGGGAACAGTTGGGGAAAC TCCCCAACTGT TTCAGGTACC NGG
511898 Deletion 11 118505003 118505006 CTGTT C ATGGGAACAGTTGGGGAAAC TCCCCAACTGTT CTTCAGGTACC NGG
444734 Deletion 11 118505275 118505275 AT A AGGGTGAGACCACCTCCCAT GGAGGTGG TTGGGACCCAG NGG
444734 Deletion 11 118505275 118505275 AT A ACTTCAGTATTGGGACCCAT GGTCCCAA CACCTCCCTG NGG
444734 Deletion 11 118505275 118505275 AT A ACTTCAGTATTGGGACCCAT GGTCCCAAT CACCTCCCTG NGG
444734 Deletion 11 118505275 118505275 AT A AGGGTGAGACCACCTCCCAT GGAGGTGGT TTGGGACCCAG NGG
444734 Deletion 11 118505275 118505275 AT A ACTTCAGTATTGGGACCCAT GGTCCCAA CCTCCCTG NGG
444734 Deletion 11 118505275 118505275 AT A ACTTCAGTATTGGGACCCAT GGTCCCAATA CACCTCCCTG NGG
444734 Deletion 11 118505275 118505275 AT A AGGGTGAGACCACCTCCCAT GGAGGTGG TATTGGGACCCAG NGG
444734 Deletion 11 118505275 118505275 AT A AGGGTGAGACCACCTCCCAT GGAGGTGG ATTGGGACCCAG NGG
444734 Deletion 11 118505275 118505275 AT A ACTTCAGTATTGGGACCCAT GGTCCCAAT CCTCCCTG NGG
444734 Deletion 11 118505275 118505275 AT A ACTTCAGTATTGGGACCCAT GGTCCCAATAC CACCTCCCTG NGG
920822 Deletion 11 118505518 118505525 GACCTCAGT G TGGTTTCAGAATCCAGCCAG GCTGGATTC GTGGTCTGTCCTCTG NGG
920822 Deletion 11 118505518 118505525 GACCTCAGT G TGGTTTCAGAATCCAGCCAG GCTGGATTC TGTGGTCTGTCCTCTG NGG
920822 Deletion 11 118505518 118505525 GACCTCAGT G TGGTTTCAGAATCCAGCCAG GCTGGATTCT GTGGTCTGTCCTCTG NGG
920822 Deletion 11 118505518 118505525 GACCTCAGT G TGGTTTCAGAATCCAGCCAG GCTGGATTCTG GTGGTCTGTCCTCTG NGG
920822 Deletion 11 118505518 118505525 GACCTCAGT G TGGTTTCAGAATCCAGCCAG GCTGGATTCT TGTGGTCTGTCCTCTG NGG
920822 Deletion 11 118505518 118505525 GACCTCAGT G TGGTTTCAGAATCCAGCCAG GCTGGATTC CTGTGGTCTGTCCTCTG NGG
920822 Deletion 11 118505518 118505525 GACCTCAGT G TGGTTTCAGAATCCAGCCAG GCTGGATTCTGAAACCA TGTGGTCTGTCCTCTG NGG
920822 Deletion 11 118505518 118505525 GACCTCAGT G TGGTTTCAGAATCCAGCCAG GCTGGATTCTGAAACCAA TGTGGTCTGTCCTCTG NGG
920822 Deletion 11 118505518 118505525 GACCTCAGT G TGGTTTCAGAATCCAGCCAG GCTGGATTCTGAAACCAA GTGGTCTGTCCTCTG NGG
920822 Deletion 11 118505518 118505525 GACCTCAGT G TGGTTTCAGAATCCAGCCAG GCTGGATTCTG TGTGGTCTGTCCTCTG NGG
966974 Deletion 11 118505605 118505626 GCTCCCTCTAGTACCCCTTCAAA G TATTAGAAACCACATCAGAA TGATGTGGTTTC ACTTGCATTGCCCCTTC NGG
966974 Deletion 11 118505605 118505626 GCTCCCTCTAGTACCCCTTCAAA G TATTAGAAACCACATCAGAA TGATGTGGTTTC AACTTGCATTGCCCCTTC NGG
966974 Deletion 11 118505605 118505626 GCTCCCTCTAGTACCCCTTCAAA G TATTAGAAACCACATCAGAA TGATGTGGTTTCT ACTTGCATTGCCCCTTC NGG
966974 Deletion 11 118505605 118505626 GCTCCCTCTAGTACCCCTTCAAA G TATTAGAAACCACATCAGAA TGATGTGGTTTCT AACTTGCATTGCCCCTTC NGG
966974 Deletion 11 118505605 118505626 GCTCCCTCTAGTACCCCTTCAAA G TATTAGAAACCACATCAGAA TGATGTGGTTTC AAACTTGCATTGCCCCTTC NGG
966974 Deletion 11 118505605 118505626 GCTCCCTCTAGTACCCCTTCAAA G TATTAGAAACCACATCAGAA TGATGTGGTTTCTA ACTTGCATTGCCCCTTC NGG
966974 Deletion 11 118505605 118505626 GCTCCCTCTAGTACCCCTTCAAA G TATTAGAAACCACATCAGAA TGATGTGGTTTCT AAACTTGCATTGCCCCTTC NGG
966974 Deletion 11 118505605 118505626 GCTCCCTCTAGTACCCCTTCAAA G TATTAGAAACCACATCAGAA TGATGTGGTTTCTA AACTTGCATTGCCCCTTC NGG
966974 Deletion 11 118505605 118505626 GCTCCCTCTAGTACCCCTTCAAA G TATTAGAAACCACATCAGAA TGATGTGGTTTCTAA ACTTGCATTGCCCCTTC NGG
966974 Deletion 11 118505605 118505626 GCTCCCTCTAGTACCCCTTCAAA G TATTAGAAACCACATCAGAA TGATGTGGTTTC AAAACTTGCATTGCCCCTTC NGG
805673 Deletion 11 118505660 118505661 CAT C TGGATGATTAGGAAGCTGGG AGCTTCCTAATC ATGACTGATTAACTTCACACCCTCCC NGG
805673 Deletion 11 118505660 118505661 CAT C TGGATGATTAGGAAGCTGGG AGCTTCCTAATCA ATGACTGATTAACTTCACACCCTCCC NGG
805673 Deletion 11 118505660 118505661 CAT C TGGATGATTAGGAAGCTGGG AGCTTCCTAATCAT ATGACTGATTAACTTCACACCCTCCC NGG
805673 Deletion 11 118505660 118505661 CAT C TGGATGATTAGGAAGCTGGG AGCTTCCTAATC AATATGACTGATTAACTTCACACCCTCCC NGG
805673 Deletion 11 118505660 118505661 CAT C TGGATGATTAGGAAGCTGGG AGCTTCCTAATCA AATATGACTGATTAACTTCACACCCTCCC NGG
805673 Deletion 11 118505660 118505661 CAT C TGGATGATTAGGAAGCTGGG AGCTTCCTAATC ATATGACTGATTAACTTCACACCCTCCC NGG
805673 Deletion 11 118505660 118505661 CAT C TGGATGATTAGGAAGCTGGG AGCTTCCTAATC TATGACTGATTAACTTCACACCCTCCC NGG
805673 Deletion 11 118505660 118505661 CAT C TGGATGATTAGGAAGCTGGG AGCTTCCTAATCA ATATGACTGATTAACTTCACACCCTCCC NGG
805673 Deletion 11 118505660 118505661 CAT C TGGATGATTAGGAAGCTGGG AGCTTCCTAATCA TATGACTGATTAACTTCACACCCTCCC NGG
805673 Deletion 11 118505660 118505661 CAT C TGGATGATTAGGAAGCTGGG AGCTTCCTAATC TAATATGACTGATTAACTTCACACCCTCCC NGG
264599 Deletion 11 118505802 118505803 CCT C GCAGTTCCTCCCACACTCTG AGTGTGGGA CACCCGTTACCACAG NGG
264599 Deletion 11 118505802 118505803 CCT C GCAGTTCCTCCCACACTCTG AGTGTGGG CACCCGTTACCACAG NGG
264599 Deletion 11 118505802 118505803 CCT C GCAGTTCCTCCCACACTCTG AGTGTGGGAG CACCCGTTACCACAG NGG
264599 Deletion 11 118505802 118505803 CCT C GCAGTTCCTCCCACACTCTG AGTGTGGGAGG CACCCGTTACCACAG NGG
264599 Deletion 11 118505802 118505803 CCT C GCAGTTCCTCCCACACTCTG AGTGTGGGA GCACCCGTTACCACAG NGG
264599 Deletion 11 118505802 118505803 CCT C GCAGTTCCTCCCACACTCTG AGTGTGGGAGGA GGCACCCGTTACCACAG NGG
264599 Deletion 11 118505802 118505803 CCT C GCAGTTCCTCCCACACTCTG AGTGTGGGAGG GCACCCGTTACCACAG NGG
264599 Deletion 11 118505802 118505803 CCT C GCAGTTCCTCCCACACTCTG AGTGTGGGAGGAA GGCACCCGTTACCACAG NGG
264599 Deletion 11 118505802 118505803 CCT C GCAGTTCCTCCCACACTCTG AGTGTGGGAGG GGCACCCGTTACCACAG NGG
264599 Deletion 11 118505802 118505803 CCT C GCAGTTCCTCCCACACTCTG AGTGTGGGAGGA GCACCCGTTACCACAG NGG
805674 Deletion 11 118505813 118505813 AG A GCAGTTCCTCCCACACTCTG AGTGTGGGA CTGTTACCACA NGG
805674 Deletion 11 118505813 118505813 AG A GCAGTTCCTCCCACACTCTG AGTGTGGG CTGTTACCACA NGG
805674 Deletion 11 118505813 118505813 AG A GCAGTTCCTCCCACACTCTG AGTGTGGGAG CTGTTACCACA NGG
805674 Deletion 11 118505813 118505813 AG A GCAGTTCCTCCCACACTCTG AGTGTGGGAGG CTGTTACCACA NGG
805674 Deletion 11 118505813 118505813 AG A GCAGTTCCTCCCACACTCTG AGTGTGGGA CCTGTTACCACA NGG
805674 Deletion 11 118505813 118505813 AG A GCAGTTCCTCCCACACTCTG AGTGTGGGAGGA CTGTTACCACA NGG
805674 Deletion 11 118505813 118505813 AG A GCAGTTCCTCCCACACTCTG AGTGTGGG CCTGTTACCACA NGG
805674 Deletion 11 118505813 118505813 AG A GCAGTTCCTCCCACACTCTG AGTGTGGGA TGTTACCACA NGG
805674 Deletion 11 118505813 118505813 AG A GCAGTTCCTCCCACACTCTG AGTGTGGGAG CCTGTTACCACA NGG
805674 Deletion 11 118505813 118505813 AG A GCAGTTCCTCCCACACTCTG AGTGTGGGAGGAA CTGTTACCACA NGG
975306 Deletion 11 118506043 118506044 CTT C GAACTTGGCGGTAAAGCCAC GCTTTACCGCC TGGCTCAATAAGCAATCTTAATCAAAGCTAGCCAGCAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
975306 Deletion 11 118506043 118506044 CTT C GAACTTGGCGGTAAAGCCAC GCTTTACCGC TGGCTCAATAAGCAATCTTAATCAAAGCTAGCCAGCAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
975306 Deletion 11 118506043 118506044 CTT C GAACTTGGCGGTAAAGCCAC GCTTTACCGC ATTGGCTCAATAAGCAATCTTAATCAAAGCTAGCCAGCAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
975306 Deletion 11 118506043 118506044 CTT C GAACTTGGCGGTAAAGCCAC GCTTTACCGCC TTGGCTCAATAAGCAATCTTAATCAAAGCTAGCCAGCAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
975306 Deletion 11 118506043 118506044 CTT C GAACTTGGCGGTAAAGCCAC GCTTTACCGC TTGGCTCAATAAGCAATCTTAATCAAAGCTAGCCAGCAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
975306 Deletion 11 118506043 118506044 CTT C GAACTTGGCGGTAAAGCCAC GCTTTACCGC TATTGGCTCAATAAGCAATCTTAATCAAAGCTAGCCAGCAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
975306 Deletion 11 118506043 118506044 CTT C GAACTTGGCGGTAAAGCCAC GCTTTACCGCC ATTGGCTCAATAAGCAATCTTAATCAAAGCTAGCCAGCAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
975306 Deletion 11 118506043 118506044 CTT C GAACTTGGCGGTAAAGCCAC GCTTTACCGCC GGCTCAATAAGCAATCTTAATCAAAGCTAGCCAGCAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
975306 Deletion 11 118506043 118506044 CTT C GAACTTGGCGGTAAAGCCAC GCTTTACCGCC TATTGGCTCAATAAGCAATCTTAATCAAAGCTAGCCAGCAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
975306 Deletion 11 118506043 118506044 CTT C GAACTTGGCGGTAAAGCCAC GCTTTACCGCC GCTCAATAAGCAATCTTAATCAAAGCTAGCCAGCAGAGCCTGGGGATTCAGGACCAGCCTGTG NGG
975307 Deletion 11 118506214 118506214 AC A GCTCCCCTCCACTCAGACTA TCTGAGTGGAGGG GCGGCTTTATGCCCGTAG NGG
975307 Deletion 11 118506214 118506214 AC A GCTCCCCTCCACTCAGACTA TCTGAGTGGAGGGG GCGGCTTTATGCCCGTAG NGG
975307 Deletion 11 118506214 118506214 AC A GCTCCCCTCCACTCAGACTA TCTGAGTGGAGG GCGGCTTTATGCCCGTAG NGG
975307 Deletion 11 118506214 118506214 AC A GCTCCCCTCCACTCAGACTA TCTGAGTGGAGGGG AGCGGCTTTATGCCCGTAG NGG
975307 Deletion 11 118506214 118506214 AC A GCTCCCCTCCACTCAGACTA TCTGAGTGGAGGG AGCGGCTTTATGCCCGTAG NGG
975307 Deletion 11 118506214 118506214 AC A GCTCCCCTCCACTCAGACTA TCTGAGTGGAGG AGCGGCTTTATGCCCGTAG NGG
975307 Deletion 11 118506214 118506214 AC A GCTCCCCTCCACTCAGACTA TCTGAGTGGAGGGG AAGCGGCTTTATGCCCGTAG NGG
975307 Deletion 11 118506214 118506214 AC A GCTCCCCTCCACTCAGACTA TCTGAGTGGAGGG AAGCGGCTTTATGCCCGTAG NGG
975307 Deletion 11 118506214 118506214 AC A CTCCCCTCCACTCAGACTAC GTCTGAGTGGAGGG AGCGGCTTTATGCCCGTA NGG
975307 Deletion 11 118506214 118506214 AC A CTCCCCTCCACTCAGACTAC GTCTGAGTGGAGGG AAGCGGCTTTATGCCCGTA NGG
682816 Deletion 11 118506267 118506267 GA G CAGTTTTGCTGGCAAGGAGC CCTTGCCAG ATGTGACCAGCT NGG
682816 Deletion 11 118506267 118506267 GA G CAGTTTTGCTGGCAAGGAGC CCTTGCCA TTCAGCATGTGACCAGCT NGG
682816 Deletion 11 118506267 118506267 GA G CAGTTTTGCTGGCAAGGAGC CCTTGCCAG CATGTGACCAGCT NGG
682816 Deletion 11 118506267 118506267 GA G CAGTTTTGCTGGCAAGGAGC CCTTGCCA ATGTGACCAGCT NGG
682816 Deletion 11 118506267 118506267 GA G CAGTTTTGCTGGCAAGGAGC CCTTGCCAGC TTCAGCATGTGACCAGCT NGG
682816 Deletion 11 118506267 118506267 GA G CAGTTTTGCTGGCAAGGAGC CCTTGCCAG TTCAGCATGTGACCAGCT NGG
682816 Deletion 11 118506267 118506267 GA G CAGTTTTGCTGGCAAGGAGC CCTTGCCA TCAGCATGTGACCAGCT NGG
682816 Deletion 11 118506267 118506267 GA G CAGTTTTGCTGGCAAGGAGC CCTTGCCA CATGTGACCAGCT NGG
682816 Deletion 11 118506267 118506267 GA G CAGTTTTGCTGGCAAGGAGC CCTTGCCA AGCATGTGACCAGCT NGG
682816 Deletion 11 118506267 118506267 GA G CAGTTTTGCTGGCAAGGAGC CCTTGCCAG TCAGCATGTGACCAGCT NGG
553179 Deletion 11 118510077 118510077 TC T GATCTGAAAGCCATCATCAC ATGATGGCT TGAAATTTCAGTG NGG
553179 Deletion 11 118510077 118510077 TC T GATCTGAAAGCCATCATCAC ATGATGGC TGAAATTTCAGTG NGG
553179 Deletion 11 118510077 118510077 TC T GATCTGAAAGCCATCATCAC ATGATGGCTT TGAAATTTCAGTG NGG
553179 Deletion 11 118510077 118510077 TC T GATCTGAAAGCCATCATCAC ATGATGGCT GAAATTTCAGTG NGG
553179 Deletion 11 118510077 118510077 TC T GATCTGAAAGCCATCATCAC ATGATGGCT TTGAAATTTCAGTG NGG
553179 Deletion 11 118510077 118510077 TC T GATCTGAAAGCCATCATCAC ATGATGGCTT GAAATTTCAGTG NGG
553179 Deletion 11 118510077 118510077 TC T GATCTGAAAGCCATCATCAC ATGATGGCT AATTTCAGTG NGG
553179 Deletion 11 118510077 118510077 TC T GATCTGAAAGCCATCATCAC ATGATGGCTTTCAGA TGAAATTTCAGTG NGG
553179 Deletion 11 118510077 118510077 TC T GATCTGAAAGCCATCATCAC ATGATGGC GAAATTTCAGTG NGG
553179 Deletion 11 118510077 118510077 TC T GATCTGAAAGCCATCATCAC ATGATGGCTTTCAGA GAAATTTCAGTG NGG
511899 Deletion 11 118519746 118519746 AC A ATTCCGTTTCCACAAGCCAG GCTTGTGGAAACG GGGGGTTCATTGGCCTCCTCTG NGG
511899 Deletion 11 118519746 118519746 AC A ATTCCGTTTCCACAAGCCAG GCTTGTGGAAACGGA GGGGGTTCATTGGCCTCCTCTG NGG
511899 Deletion 11 118519746 118519746 AC A ATTCCGTTTCCACAAGCCAG GCTTGTGGAAACGG GGGGGTTCATTGGCCTCCTCTG NGG
511899 Deletion 11 118519746 118519746 AC A ATTCCGTTTCCACAAGCCAG GCTTGTGGAAACGG AGGGGGTTCATTGGCCTCCTCTG NGG
511899 Deletion 11 118519746 118519746 AC A ATTCCGTTTCCACAAGCCAG GCTTGTGGAAACGGA AGGGGGTTCATTGGCCTCCTCTG NGG
511899 Deletion 11 118519746 118519746 AC A ATTCCGTTTCCACAAGCCAG GCTTGTGGAAACG AGGGGGTTCATTGGCCTCCTCTG NGG
511899 Deletion 11 118519746 118519746 AC A ATTCCGTTTCCACAAGCCAG GCTTGTGGAAAC GGGGGTTCATTGGCCTCCTCTG NGG
511899 Deletion 11 118519746 118519746 AC A GAGCCGTGAGGGTTCAAGGG TTGAACCC AGGAGGCCAATGAACCCCC NGG
511899 Deletion 11 118519746 118519746 AC A ATTCCGTTTCCACAAGCCAG GCTTGTGGAAACGG AAGGGGGTTCATTGGCCTCCTCTG NGG
511899 Deletion 11 118519746 118519746 AC A GAGCCGTGAGGGTTCAAGGG TTGAACCCT AGGAGGCCAATGAACCCCC NGG
969790 Deletion 11 118520020 118520020 AC A CTCCTCCTCTTCTTCATCAT ATGAAGAAGAGGA GAATACAACCCAATG NGG
969790 Deletion 11 118520020 118520020 AC A CTCCTCCTCTTCTTCATCAT ATGAAGAAGAGGA TGAATACAACCCAATG NGG
969790 Deletion 11 118520020 118520020 AC A CTCCTCCTCTTCTTCATCAT ATGAAGAAGAGGA AATACAACCCAATG NGG
969790 Deletion 11 118520020 118520020 AC A CTCCTCCTCTTCTTCATCAT ATGAAGAAGAGGA CTGAATACAACCCAATG NGG
969790 Deletion 11 118520020 118520020 AC A CTCCTCCTCTTCTTCATCAT ATGAAGAAGAGGAG GAATACAACCCAATG NGG
969790 Deletion 11 118520020 118520020 AC A CTCCTCCTCTTCTTCATCAT ATGAAGAAGAGGAG TGAATACAACCCAATG NGG
969790 Deletion 11 118520020 118520020 AC A CTCCTCCTCTTCTTCATCAT ATGAAGAAGAGG GAATACAACCCAATG NGG
969790 Deletion 11 118520020 118520020 AC A CTCCTCCTCTTCTTCATCAT ATGAAGAAGAGGAGG GAATACAACCCAATG NGG
969790 Deletion 11 118520020 118520020 AC A CTCCTCCTCTTCTTCATCAT ATGAAGAAGAGGAG AATACAACCCAATG NGG
969790 Deletion 11 118520020 118520020 AC A CTCCTCCTCTTCTTCATCAT ATGAAGAAGAGG TGAATACAACCCAATG NGG